Log In Sign up
The largest database of trusted experimental protocols

Px459

Manufactured by Addgene
Visit Supplier
Sourced in United States, China

PX459 is a plasmid that enables the CRISPR/Cas9 gene editing system. It contains a Cas9 expression cassette and a sgRNA expression cassette, allowing for the targeting and modification of specific genomic sequences.

Automatically generated - may contain errors

Lab products found in correlation

Px459, by Thermo Fisher Scientific (8 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (8 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (7 mentions) Px458, by Addgene (6 mentions) Lenticrispr v2, by Addgene (4 mentions) Puromycin, by Merck Group (4 mentions) Puromycin, by Thermo Fisher Scientific (4 mentions) Px462, by Addgene (3 mentions) Pminit 2, by New England Biolabs (2 mentions) Feeder cells, by Thermo Fisher Scientific (2 mentions) Xfect, by Takara Bio (2 mentions) Facsaria 3, by BD (2 mentions) Nucleofection, by Lonza (2 mentions) Dneasy blood and tissue kit, by Qiagen (2 mentions) Px459, by Promega (2 mentions) Fugene hd, by Promega (2 mentions) Puromycin, by InvivoGen (2 mentions) Crispr cas9 genome editing, by Addgene (2 mentions) Quikchange site directed mutagenesis kit, by Agilent Technologies (2 mentions) Pcag egxxfp, by Addgene (2 mentions)

104 protocols using px459

1

CRISPR-Mediated ITGB3 Knockout in 143B Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
To knock out ITGB3 in 143B cells, sgRNA (single guide RNA) sequences spanning exon 3 and exon 4 of ITGB3 were designed to decrease the potential off‐target points by using a web‐based tool (http://www.e‐crisp.org/E‐CRISP/). Then, the two sequences of each point were annealed and ligated into the vector pX459 (Addgene; #62988) to generate two plasmid constructs, pX459‐ITGB3‐gRNA1 and pX459‐ITGB3‐gRNA2. These two vectors were coelectroporated into 143B cells by using the Neon Transfection System (Thermo). After 24 h of cultivation, 1 μg/ml puromycin was added and selected for 48 h, and then the electroporated cells were seeded on 10 cm dishes at a very low density of approximately 2000 cells/dish. On day 14, we manually picked approximately 100 puromycin‐resistant colonies into 96‐well plates and then expanded them separately. Genomic DNA was purified from these picked cell colonies, and the homozygous mutant cells were confirmed via PCR amplification and Sanger sequencing by using specific primers that spanned the knockout fragments. The oligo sequences of the two gRNAs and the detected primers were as follows:
ITGB3‐gRNA1: TCACTCAAGTCAGTCCCCAG
ITGB3‐gRNA2: GGTGAGCTTTCGCATCTGGG
ITGB3‐KO‐F: ATAGCAGGGGTTTTCGAGGG
ITGB3‐KO‐R: GCCATAGCTCTGATTGCTGG
Li Q., Chen G., Jiang H., Dai H., Li D., Zhu K., Zhang K., Shen H., Xu H, & Li S. (2023). ITGB3 promotes cisplatin resistance in osteosarcoma tumors. Cancer Medicine, 12(7), 8452-8463.
+ Open protocol
+ Expand
2

Generation of ORP9 Knockout HeLa Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
ORP9 knockout (KO) HeLa cells were generated by first identifying two gRNAs directed to the exon 16 of ORP9, which encodes the ORD, using CRISPOR (http://crispor.tefor.net/)105 (link). The ORP9 genomic sequences targeted by the predicted CRISPR gRNAs are: GAAGGATCCCAAGGATCGAA (ORP9-sgRNA#1) and TCGCCCAAAATGGGATTGTA (ORP9-sgRNA#2). The two CRISPR targeting sites were synthesized by annealing ORP9-sgRNA#1_S and ORP9-sgRNA#1_AS for ORP9-sgRNA#1, and ORP9-sgRNA#2_S and ORP9-sgRNA#2_AS for ORP9-sgRNA#2, respectively, and individually sub-cloned into PX459 (Addgene: #62988) to generate PX459-ORP9_sgRNA_#1 and PX459-ORP9_sgRNA_#2. Wild-type or GRAMD1 triple knock-out (TKO) HeLa cells53 (link) were transiently transfected with the two ORP9 CRISPR/Cas9 plasmids. 24 h after transfection, cells were supplemented with growth media containing puromycin (1.5 µg/mL) and incubated for 72 h. Cells resistant to puromycin were then incubated with puromycin-free medium for 24 h before harvesting for single cell sorting, and individually isolated clones were assessed by genotyping PCR using the primer set, ORP9_Exon16_GT_S2 and ORP9_Exon16_GT_AS2, to obtain ORP9 KO cell lines or quadruple knock-out (QKO) (lacking both GRAMD1s and ORP9) cell lines.
Naito T., Yang H., Koh D.H., Mahajan D., Lu L, & Saheki Y. (2023). Regulation of cellular cholesterol distribution via non-vesicular lipid transport at ER-Golgi contact sites. Nature Communications, 14, 5867.
+ Open protocol
+ Expand
3

Generating CRISPR Knockout Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Oligos targeting the first exon of the CNOT2 or Hipk2 genes were cloned into pX459 (Addgene) to obtain the pX459-CNOT2 and pX459-HIPK2 plasmids. 293T cells were transfected with either pX459 targeting the luciferase gene or pX459-CNOT2, and HeLa cells were transfected with the plasmid pX459-HIPK2. The next day, puromycin (1 μg/ml) was added for 3 d to kill the untransfected cells. Single-cell clones were isolated and tested for expression of the CNOT2 or HIPK2 proteins and Cas9 by Western blotting. Cells expressing neither CNOT2 nor HIPK2 and also lacking Cas9 expression were used for the subsequent experiments. The Indel mutations in the knockout clones were characterized by sequencing of the genomic DNA.
Rodriguez-Gil A., Ritter O., Hornung J., Stekman H., Krüger M., Braun T., Kremmer E., Kracht M, & Schmitz M.L. (2016). HIPK family kinases bind and regulate the function of the CCR4-NOT complex. Molecular Biology of the Cell, 27(12), 1969-1980.
+ Open protocol
+ Expand
4

CRISPR-mediated FANCD2 knockout in HeLa cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The targeting sequence used in the sgRNA was: 5′-GTTTGTCTTGTGAGCGTCTGC-3′. HeLa-FANCD2−/− cells were generated using plasmid pX459 (Addgene #48139) as follows20 (link): primers, 5′-CACCGTTTGTCTTGTGAGCGTCTGC-3′ and 5′-AAACGCAGACGCTCACAAGACAAAC-3′, were annealed and introduced into the pX459 plasmid through its BbsI site. HeLa cells were transfected with 2 μg of the resulting pX459 plasmid and selected with 4 μg ml−1 puromycin after 24 h. After another 24 h, cells were plated at low density and clones were picked after 2 weeks. Clones were analysed using immunoblot analysis.
Liang C.C., Li Z., Lopez-Martinez D., Nicholson W.V., Vénien-Bryan C, & Cohn M.A. (2016). The FANCD2–FANCI complex is recruited to DNA interstrand crosslinks before monoubiquitination of FANCD2. Nature Communications, 7, 12124.
+ Open protocol
+ Expand
5

CRISPR Plasmid Cloning and Verification

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The empty vector for the expression of single guide RNAs, pX459 was obtained from Addgene. Oligos that are listed in a supplementary table were annealed and inserted into the Bbs I sites of pX459 (Addgene, Cambridge, MA, plasmid 48139) by Golden Gate assembly (Engler et al., 2008 (link)) as previously described (Ran et al., 2013 (link)), using Bpi I (Thermo Fisher Scientific K.K., Kanagawa, Japan) and T4 DNA ligase (New England Biolabs, Ipswich, MA). Plasmids were transformed in ECOS competent Escherichia coli JM109 (Nippon Gene Co., Ltd., Toyama, Japan). Sequences were verified by a sequencing service (Eurofins Genomics K.K., Tokyo, Japan), and plasmids were purified using a Plasmid Midi Kit (Qiagen K.K., Tokyo, Japan).
Hashidate-Yoshida T., Harayama T., Hishikawa D., Morimoto R., Hamano F., Tokuoka S.M., Eto M., Tamura-Nakano M., Yanobu-Takanashi R., Mukumoto Y., Kiyonari H., Okamura T., Kita Y., Shindou H, & Shimizu T. (2015). Fatty acid remodeling by LPCAT3 enriches arachidonate in phospholipid membranes and regulates triglyceride transport. eLife, 4, e06328.
+ Open protocol
+ Expand
6

CRISPR-Cas9 Correction of iPSC Mutation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genetic correction of iPSCs carrying the p.1400S>G mutation was performed by CRISPR/Cas9 technology as detailed previously (54 (link)). The guide RNA sequence (sgRNA: 5′ - AAAGTTTTGTCTCCTTTACG - 3′) was designed in the CRISPR Design Tool and cloned into the plasmid pX459 (Addgene) to construct the plasmid pX459 sgRNA. Nucleofection technology was used to transfect the plasmid pX459-sgRNA and a 151 bp–corrected single-stranded donor oligonucleotide (ssODN) into mutant iPSCs by Human Stem Cell Nucleofector Kit (Lonza, VPH-5012). The cells were selected by 0.5 μg/mL puromycin 48 hours after nucleofection. Survival cells treated with 0.5 μg/mL puromycin were propagated into clones, collected, and analyzed by Sanger sequencing.
Cui L., Zheng J., Zhao Q., Chen J.R., Liu H., Peng G., Wu Y., Chen C., He Q., Shi H., Yin S., Friedman R.A., Chen Y, & Guan M.X. (2020). Mutations of MAP1B encoding a microtubule-associated phosphoprotein cause sensorineural hearing loss. JCI Insight, 5(23), e136046.
+ Open protocol
+ Expand
7

CRISPR-Mediated Knockout of FLOT1 and AGA

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Five different mammalian Cas9 genome editing constructs encoding gRNAs for FLOT1 were obtained from Horizon Discovery (Cambridge, UK). The vector backbone for all constructs was pD1301-AD. Guide RNA sequences are shown in Table 1.
For knocking out the expression of aspartylglucosaminidase (AGA) in HEK293T cells, gRNAs were designed with the “optimized CRISPR design” tool (www.crisp.mit.edu) and cloned into PX459 (Addgene #48139) [2 (link)]. Transfection and cultivation of single-cell clones was performed as described for FLOT1. For the screening of single-cell clones, AGA enzyme activity was measured as described [11 (link)]. The gRNA sequence used was 5’-CACCGATACCCTCCAATAATTTGGC-3’.
Kapahnke M., Banning A, & Tikkanen R. (2016). Random Splicing of Several Exons Caused by a Single Base Change in the Target Exon of CRISPR/Cas9 Mediated Gene Knockout. Cells, 5(4), 45.
+ Open protocol
+ Expand
8

Establishment of FANCM and MSH3 Knockout Cell Lines

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Human U2OS, HCT116, and 293T cells were cultured in DMEM supplemented with 10% fetal bovine serum at 37°C and 5% CO2. The FANCM-knockout HCT116 cells used in this study have been previously described (53 (link)).
MSH3-knockout (KO) in EGFP-HR-Flex reporter (U2OS) cells was generated using CRISPR–Cas9 technology. A gRNA sequence (TGAACAAACAGTCTGTGAGT) targeting the fifth exon of human MSH3 was sub-cloned into PX459 (Addgene#62988) for making MSH3-KO. Transfected cells with this plasmid were subjected to puromycin selection for 48 hours, followed by isolation of single clones. The MSH3-KO clones were confirmed by Western blot analysis.
Li Y., Zhang Y., Shah S.B., Chang C.Y., Wang H, & Wu X. (2023). MutSβ protects common fragile sites by facilitating homology-directed repair at DNA double-strand breaks with secondary structures. Nucleic Acids Research, 52(3), 1120-1135.
+ Open protocol
+ Expand
9

CRISPR/Cas9-mediated B2M gene editing

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pX260 and pX459 plasmids (Addgene, Cambridge, MA, USA) containing a CRISPR/Cas9 system, which was described previously23 (link),24 (link), were used in this study. Target sequences of CRISPR/Cas9 were designed by CHOPCHOP (http://chopchop.cbu.uib.no/) and listed in Table S1. The B2M Target1 was subcloned into pX260, while the B2M Target2 was subcloned into pX459. Two donor plasmids for B2M Exon1 homology-direct integration were constructed. One was designed with a eukaryotic translation elongation factor 1α (EF1α) promoter driving the expression of an EGFP gene and a mouse phosphoglycerate kinase 1 (PGK) promoter driving the expression of the Neo gene (the neomycin resistant gene), while the other was designed with the EF1α promoter driving the expression of a mCherry gene and a Simian virus 40 (SV40) promoter driving the expression of the Hygro gene (the hygromycin resistant gene). Both donor sequences were flanked by homologous DNA sequences from B2M EX1 locus (chromosome 15: nucleotides 44,710,501–44,711,401 and nucleotides 44,711,615–44,712,485, GRCh38.p2 Primary Assembly).
Zha S., Tay J.C., Zhu S., Li Z., Du Z, & Wang S. (2020). Generation of Mesenchymal Stromal Cells with Low Immunogenicity from Human PBMC-Derived β2 Microglobulin Knockout Induced Pluripotent Stem Cells. Cell Transplantation, 29, 0963689720965529.
+ Open protocol
+ Expand
10

Generation of Parkin Knockout HEK293T Cell Line

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Using a CRISPR/Cas-9 approach, as we have previously described23 (link), we generated a Parkin knockout (KO) HEK293T cell line. In brief, HEK293T cells were transiently transfected with two gRNA-Cas9 plasmids (px459, Addgene 62988), each encoding a sgRNA-targeting exon one of PARK2 gene;
sgRNA1: CTCCAGCCATGGTTTCCCAG and sgRNA2: CTGCGAAAATCACACGCAAC.
After 48 h, puromycin is added for selection of transfected cells. Clonal cell lines were isolated by serial dilution to isolate single cells per well in a 96 well dish. Each colony was screened for shorter fragment with primers external to exon 1, F:AAGGGCTTCGAGTGATGCTC, R: CCTTGCTGCTCCTGTAGTCA. Confirmation of genetic knockout was confirmed by Sanger sequencing. The wild-type (WT) HEK293T cell line was used as a control for comparison. HEK293T cells were maintained at 37 °C and 5% CO2 in DMEM (Life Technologies) supplemented with 10% FBS (Life Technologies), and 1% penicillin/streptomycin (Life Technologies).
De Snoo M.L., Friesen E.L., Zhang Y.T., Earnshaw R., Dorval G., Kapadia M., O’Hara D.M., Agapova V., Chau H., Pellerito O., Tang M.Y., Wang X., Schmitt-Ulms G., Durcan T.M., Fon E.A., Kalia L.V, & Kalia S.K. (2019). Bcl-2-associated athanogene 5 (BAG5) regulates Parkin-dependent mitophagy and cell death. Cell Death & Disease, 10(12), 907.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!