Gotaq flexi polymerase

Manufactured by Promega

Sourced in United States, Germany, France

GoTaq Flexi DNA Polymerase is a thermostable DNA polymerase used for PCR amplification. It has 5'-to-3' DNA polymerase activity and 3'-to-5' exonuclease activity.

Automatically generated - may contain errors

Lab products found in correlation

Geneamp pcr system 9700, by Thermo Fisher Scientific (4 mentions) Gotaq flexi buffer, by Promega (3 mentions) Mgcl2, by Promega (2 mentions) Gel doc xr system, by Bio-Rad (2 mentions) Biometra thermal cycler t gradient, by Analytik Jena (2 mentions) Pgem t easy vector, by Promega (2 mentions) T4 rna ligase, by New England Biolabs (2 mentions) Superscript 4, by Thermo Fisher Scientific (2 mentions) In fusion hd cloning kit, by Takara Bio (2 mentions) Qiaamp dna blood maxi kit, by Qiagen (2 mentions) M mlv reverse transcriptase, by Thermo Fisher Scientific (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Nanodrop one onec microvolume uv vis spectrophotometer, by Thermo Fisher Scientific (1 mentions) Dna 7500 chip, by Agilent Technologies (1 mentions) Dneasy blood tissue, by Qiagen (1 mentions) Instagene kit, by Bio-Rad (1 mentions) Gelred stain, by Biotium (1 mentions) Lightcycler 480, by Roche (1 mentions) Abi 3130, by Thermo Fisher Scientific (1 mentions) Genematrix bio trace dna purification kit, by EURx (1 mentions)

32 protocols using gotaq flexi polymerase

BRCA1 Gene Variant Detection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated using DNeasy Blood & Tissue (Qiagen, Hilden, Germany) and DNA concentrations were measured using a NanoDrop™ One/OneC Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA). Primers were designed to anneal around the Cas9 cutting site within the BRCA1 gene. To detect small indel variations, a short sequence around the Cas9 cutting site was amplified, while to detect larger variations a longer fragment was amplified (Table 3)
For PCR, GoTaq^® Flexi Polymerase (Promega, Walldorf, Germany) with the Green GoTaq^® Flexi Reaction Buffer supplemented with 5 mM MgCl₂, 200 µM dNTPs, 100 pmol/µL forward and reverse primer, and 100 ng genomic DNA as template was used. PCR was performed using a Primus 25 advanced^® Thermocycler with the following conditions: Initial denaturation (95 °C for 2 min) followed by 35 cycles of denaturation (95 °C for 30 s), annealing (54 °C for 30 s) and extension (72 °C for 50 s), ending with a final extension (72 °C for 10 min). Fragments were then loaded on to a 2% agarose gel, run for 30 min at 120 V, and stained with ethidium bromide, or analyzed by BioAnalyzer 2100 Expert (B.02.08.SI648) using DNA 7500 chips (Agilent Technologies, Santa Clara, CA, USA).

Classen S., Rahlf E., Jungwirth J., Albers N., Hebestreit L.P., Zielinski A., Poole L., Groth M., Koch P., Liehr T., Kankel S., Cordes N., Petersen C., Rothkamm K., Pospiech H, & Borgmann K. (2022). Partial Reduction in BRCA1 Gene Dose Modulates DNA Replication Stress Level and Thereby Contributes to Sensitivity or Resistance. International Journal of Molecular Sciences, 23(21), 13363.

+ Open protocol

+ Expand

ERIC-PCR for Variant Validation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

ERIC-PCR was used to compare the patterns observed for the variants and their parental strain to ensure that the different collected variants were not due to contamination as previously described (Cuzin et al., 2021 (link)). DNA was first extracted using an InstaGene kit (Bio-rad, Marnes-la-Coquette, France) and amplified using a LightCycler^® 480 thermocycler (Roche Diagnostics, Meylan, France) with primers ERIC1-R (ATGTAAGCTCCTGGGGATTCAC) and ERIC2 (AAGTAAGTGACTGGGGTGAGCG) and GoTaq Flexi polymerase (Promega, Charbonnières-les-bains, France) as follows: 95 °CC for 2 min for initial melting; 30 cycles at 95 °CC for 1 min, 54 °CC for 1 min, 72 °CC for 4 min; final extension at 72 °CC for 8 min followed by incubation at 4 °CC. PCR products were then checked on 1% agarose gel and migrated over 90 min at 110 V before being revealed using a GelRED stain (Biotium, Brumath, France).

Charron R., Lemée P., Huguet A., Minlong O., Boulanger M., Houée P., Soumet C., Briandet R, & Bridier A. (2023). Polyhexamethylene biguanide promotes adaptive cross-resistance to gentamicin in Escherichia coli biofilms. Frontiers in Cellular and Infection Microbiology, 13, 1324991.

+ Open protocol

+ Expand

Oral Mucosal 5-HTTLPR Genotyping

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA isolation from oral mucosal swabs was carried out using professional disposable swabs. Sampling took place approximately 2 hours after a meal or while fasting. In addition, the test subjects were not allowed to smoke cigarettes or chew gum for approximately 2 hours as well.
The polymorphism of the gene encoding the serotonin transporter 5-HTTLPR (SLC6A4) was determined from isolated DNA. Its homozygous variants of short/short or long/long alleles and heterozygous short/long alleles were analysed in the study.
DNA from buccal swabs was extracted by GeneMATRIX Bio-Trace DNA Purification Kit (EurX) according to the manufacturer’s instructions. Genotyping of 5-HTT LPR was performed utilizing PCR-based method following by fragment analysis in a capillary electrophoresis sequencer ABI3130 (Thermo Fisher Scientific). The PCR reactions consisted of 15 ng of total DNA, 15 pmol of each primer (forward: 5’-6FAM-ATGCCAGCACCTAACCCCTAATGT-3’ and reverse: 5’-GGACCGCAAGGTGGGCGGGA-3’), 1 U of Go Taq Flexi polymerase, 1x PCR Buffer, 0,2 mM dNTP, 1,5 mM MgCl₂ (Promega) and milli-Q water to a total volume of 20μL. The thermal profile composed of: 10 min at 94°C and 35 cycles of the following steps: denaturation 94°C, 1 min, annealing 66°C, 1 min, and extension 72°C, 1 min. The results of genotyping were analysed using GeneMapper v3.2 software.

Czarnecki D., Ziółkowski M., Chodkiewicz J., Gorzkiewicz M., Waszkiewicz N., Długosz A., Budzyński J., Junkiert-Czarnecka A, & Kułak-Bejda A. (2023). The Lack of Influence of Homozygous Long Allele of the 5-HTTLPR Gene on the Severity of Alcohol Craving During 6 Weeks of Rehab Hospitalisation in Comparison to Not Homozygous and Homozygous Short Alleles – Preliminary Report. Psychology Research and Behavior Management, 16, 497-507.

+ Open protocol

+ Expand

ISSR PCR Amplification for Genetic Studies

Check if the same lab product or an alternative is used in the 5 most similar protocols

For ISSR PCR amplification [38 (link),39 (link)], a set of 15 ISSR primers were applied against the 9 treatments. The PCR was carried out in a total volume of 25 μl containing the following components: 25 ng genomic DNA; 1X PCR buffer; 1.5 mM MgCl₂; 0.25 mM of each dNTPs; 1 μM of each primer; 1 U Go-Taq Flexi polymerase (Promega).
Thermocycling amplification was performed with a GeneAmp PCR system 9700 (Applied Biosystem, Inc.). The amplification was programmed at 94°C for 5 min for the initial denaturation cycle, followed by 35 cycles with each cycle comprising 94°C for 1 min, 50°C for 1 min, then 72°C for 90 s; and a final extension at 72°C for 7 min. The produced PCR amplicons were electrophoresed using 1.5% agarose gel. A 100 bp plus DNA ladder and 1 kb were used as molecular size standards. PCR products were photographed using a Gel Doc™ XR+ System (Bio-Rad®).

Awad M., Ibrahim E.D., Osman E.I., Elmenofy W.H., Mahmoud A.W., Atia M.A, & Moustafa M.A. (2022). Nano-insecticides against the black cutworm Agrotis ipsilon (Lepidoptera: Noctuidae): Toxicity, development, enzyme activity, and DNA mutagenicity. PLoS ONE, 17(2), e0254285.

+ Open protocol

+ Expand

PCR Screening of Xanthomonas Copper Resistance

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fifty‐one and 27 X. citri pv. citri isolates collected in grove 1 and grove 2, respectively, were assayed for the presence of copL by PCR amplification from boiled bacterial suspensions. PCRs were mostly performed as reported previously (Behlau, Hong, Jones, & Graham, 2013). However, we used GoTaq Flexi Polymerase (Promega, Charbonnières‐les‐Bains, France), decreased the primer concentration (5 pmol/μl), and set the annealing temperature at 66°C. PCR amplification, using copA and copB primers, was also performed on a subset of samples with GoTaq Flexi Polymerase and the other conditions reported above. The copper‐resistant X. citri pv. citri strain LH201 was used as a positive control in each experiment (Richard et al., 2017).

Pruvost O., Boyer K., Ravigné V., Richard D, & Vernière C. (2019). Deciphering how plant pathogenic bacteria disperse and meet: Molecular epidemiology of Xanthomonas citri pv. citri at microgeographic scales in a tropical area of Asiatic citrus canker endemicity. Evolutionary Applications, 12(8), 1523-1538.

+ Open protocol

+ Expand

Inversion Breakpoint Amplification Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Four primers were designed to amplify segments that encompass the two breakpoints of the inversion based on the Bos_taurus_UMD_3.1/bosTau6 assembly (UCSC Genome Browser Gateway) using the Primer3 software [52 (link)]. Details on the PCR primers are in Additional file 3: Table S3. Four independent PCR reactions were performed to amplify the mutant and wild type alleles using the GO-Taq Flexi polymerase (Promega) according to the manufacturer’s instructions on a Mastercycle pro thermocycler (Eppendorf). Aliquots of PCR products were pooled for ethidium bromide-stained 2% agarose gel electrophoresis. The remaining amplicons were purified and sequenced by Eurofins (Eurofins MWG, Ebersberg Germany) using conventional Sanger sequencing.

Escouflaire C., Rebours E., Charles M., Orellana S., Cano M., Rivière J., Grohs C., Hayes H, & Capitan A. (2019). Α de novo 3.8-Mb inversion affecting the EDA and XIST genes in a heterozygous female calf with generalized hypohidrotic ectodermal dysplasia. BMC Genomics, 20, 715.

+ Open protocol

+ Expand

Quantification of VEGF and Survivin mRNA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using the phenol-chloroform method. RNA (2 µg) was used for reverse transcription, as described previously [92 (link)]. VEGF and β-actin cDNA were amplified by traditional PCR using GoTaq flexi polymerase (Promega, Madison, WI, USA). Survivin mRNA levels were assessed by real time PCR using Brilliant II SybrGreen QPCR master mix (Agilent Technologies, Santa Clara, CA, USA). All primers used are described in Supplementary Table S1. β-actin expression was used as invariant control gene. Sterile water instead of cDNA was added as a negative control for the reactions.

Garrido M.P., Salvatierra R., Valenzuela-Valderrama M., Vallejos C., Bruneau N., Hernández A., Vega M., Selman A., Quest A.F, & Romero C. (2020). Metformin Reduces NGF-Induced Tumour Promoter Effects in Epithelial Ovarian Cancer Cells. Pharmaceuticals, 13(10), 315.

+ Open protocol

+ Expand

Amplification of 16S rRNA V4 Region

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the amplification of the V4 region of the 16S rRNA gene the primer set 520F (5′-AYTGGGYDTAAAGNG-3′) and 802R (5′-TACNVGGGTATCTAATCC-3′) (with Y = C/T, D = A/G/T, N = any base, V = A/C/G) [29] (link) was utilized. Primers included at their 5′ end the adaptor sequence used in the 454-sequencing library preparation protocol, linked to a unique MID tag barcode of 10 bases that allowed the identification of the different samples. PCR mixtures contained 0.5 µM of each forward and reverse primer, 100 ng of template DNA, 2.5 U of GoTaq Flexi Polymerase (Promega), 200 µM of dNTPs and 2 mM of MgCl₂ in a final volume of 50 µL. Samples were initially denatured at 95°C for 5 min, followed by 35 cycles of 94°C for 50 s, 40°C for 30 s, and 72°C for 60 s, with a final extension step at 72°C for 5 min [24] (link). PCR amplifications were carried out in a Biometra Thermal Cycler T Gradient (Biometra).

Biagi E., Candela M., Centanni M., Consolandi C., Rampelli S., Turroni S., Severgnini M., Peano C., Ghezzo A., Scurti M., Salvioli S., Franceschi C, & Brigidi P. (2014). Gut Microbiome in Down Syndrome. PLoS ONE, 9(11), e112023.

+ Open protocol

+ Expand

16S rRNA Gene Amplification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

All the oligonucleotide probes were synthesized by Thermo Fisher Scientific (Ulm, Germany). 16 S rRNA gene was amplified by using a Biometra Thermal Cycler II (Biometra, Gottingen, Germany) and 2.5 U of GoTaq Flexi polymerase (Promega, Madison, WI) in a final volume of 50 μL following the protocol described in Cruciani et al.^{26 (link)}. PCR products were purified by using a High Pure PCR Clean up Micro kit (Roche, Mannheim, Germany), following the manufacturer instructions, and quantified by NanoDrop ND-1000.

Parolin C., Giordani B., Ñahui Palomino R.A., Biagi E., Severgnini M., Consolandi C., Caredda G., Storelli S., Strohmenger L, & Vitali B. (2017). Design and validation of a DNA-microarray for phylogenetic analysis of bacterial communities in different oral samples and dental implants. Scientific Reports, 7, 6280.

+ Open protocol

+ Expand

Intermediate Leptospira Spp. Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

We designed a Leptospira spp. assay to target only intermediate Leptospira spp. We used Primer3 (19 (link)) to design a reverse primer (R Inter: 5′-TCTTTACCTATCARATCYTGTGATCCA-3′) to be used with A or C forward primers; amplicon sizes were 160 bp for A and 143 bp for C. The specificity of this assay was validated with 17 leptospiral DNA samples from reference strains of pathogenic, saprophytic, and intermediate leptospiral species obtained from the Royal Tropical Institute (Table 1). We tested for the intermediate leptospiral genotype in 75 human serum samples from Portoviejo that were real-time PCR positive for Leptospira spp. The real-time PCR amplicons were subjected to a second PCR amplification using R-Inter reverse primer. The total reaction volume of the intermediate-specific real-time PCR assay, using GoTaq Flexi Polymerase (Promega, Madison, WI, USA), was 20 μL; 0.5 μL of the real-time PCR amplicon was used as template for the conventional PCR.

Chiriboga J., Barragan V., Arroyo G., Sosa A., Birdsell D.N., España K., Mora A., Espín E., Mejía M.E., Morales M., Pinargote C., Gonzalez M., Hartskeerl R., Keim P., Bretas G., Eisenberg J.N, & Trueba G. (2015). High Prevalence of Intermediate Leptospira spp. DNA in Febrile Humans from Urban and Rural Ecuador. Emerging Infectious Diseases, 21(12), 2141-2147.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!