α 32p datp

Highly pure dNTPs were supplied by GE Healthcare [γ-³²P]ATP and [α-³²P]dATP (3,000 Ci/mmol) were purchased from PerkinElmer. PAGE-purified oligonucleotides (Table S1) were synthesised by Sigma or IDT. As indicated in Table S1, some oligonucleotides contained modified bases, abbreviated as follows: tetrahydrofuran (THF) as an abasic site analog, cyclobutane thymine dimer (T:T) or thymine glycol (Tg).

Total RNA was isolated using TRIzol reagent (Life Technologies) and treated with RQ1 RNase-free DNase (Promega). RNA isolated from human tissue was purchased from Ambion (FirstChoice Human Total RNA Survey panel); samples from each tissue were pooled from three individuals. cDNA was generated using SuperScript III (Life Technologies) and amplified using Taq DNA Polymerase (New England Biolabs) in the presence of either a 5′-end-³²P-labelled primer or a trace amount of [α-³²P] dATP (3,000 Ci/mmole; Perkin-Elmer). MESDA was performed as previously described31 (link). For quantitative real-time PCR (QPCR), reactions were carried out using FastStart Universal SYBR Green Master Mix (Roche). For detailed methods, see Supplementary Experimental Methods. All primer sequences appear in Supplementary Table 1.

The 73-mer DNA fragment containing the embedded TFO target sequence used in footprinting experiments is shown in Supplementary Figure S1f. This was prepared by blunt-end cloning of the duplex shown in Supplementary Figure S1f into the SmaI site of pUC18. Incorporation of the intended duplex was confirmed by sequencing (MWG Eurofins). The recombinant plasmid was transformed into competent Escherichia coli TG2 cells and the plasmid isolated using a Qiagen Miniprep kit. The plasmid was subsequently digested by HindIII and SacI (New England Biolabs) and radiolabelled at the 3′-end of the HindIII site using exo-Klenow fragment (New England Biolabs) and [α-³²P]dATP (Perkin Elmer). The fragment was separated from the remainder of the plasmid on an 8% (w/v) non-denaturing polyacrylamide gel. After elution, the fragment was dissolved in 10 mM Tris–HCl pH 7.0 to give ∼10 c.p.s./μl as determined on a hand held Geiger counter (<10 nM DNA).

Viral RNA (equivalent of 50 ng CA-p24) in 12 µl buffer (83 mM Tris-HCl pH 7.5, 125 mM KCl) was either used directly for tRNA^lys3 extension or was mixed with primer CN1 (GGTCTGAGGGATCTCTAGTTACCAGAGTC, complementary to nucleotides 123–151 of LAI RNA), heated at 85°C for 2 min, at 65°C for 10 min, followed by slow-cooling to room temperature over 1 h to allow primer annealing. 6 µl 3x RT buffer (9 mM MgCl₂, 30 mM DTT, 150 µg/ml actinomycin D, 30 µM dCTP, 30 µM dGTP, 30 µM dTTP and 1.5 µM dATP [Thermo-Scientific], 0.3 µl α32P-dATP [0.33 MBq/µl, Perkin-Elmer], 22 nM HIV-1 RT [2.5 U per sample; p51/p66 heterodimer; kindly provided by D. Stammers, Glaxo Wellcome Research Laboratories, MRC AIDS reagent project] was added to the tRNA^lys3 and CN1 extension samples. The mixture was incubated at 37°C for 30 min to extend the naturally associated tRNA^lys3 primer or the annealed CN1 DNA primer. The cDNA was precipitated in 25 mM EDTA, 0.3 M NaAc pH 5.2 and 80% EtOH at –20°C. cDNA pellets were washed with 70% ethanol and dissolved in gel-loading buffer II (Ambion). The cDNA was analyzed on a denaturing 6% polyacylamide-urea sequencing gel and bands were quantified using a phosphorimager (Amersham Biosciences) and ImageQuant software.

Human anti-CD44-PE Antibody, human anti-CD133-PE Antibody, and FcR Blocking Reagent were purchased from MACS Miltenyi Biotech (Bergisch Gladbach, Germany). Mouse anti-CKII (#sc-373894) and mouse anti-LAMIN B (#sc-365214) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA), rabbit anti-p14ARF (#SAB4500073) was from Sigma-Aldrich ApS (Søborg, Denmark) and human anti-TOP1 (#TG2012) was from TopoGEN (Buena Vista, CO, USA). Horse radish peroxidase, HRP conjugated goat anti-mouse, goat anti-human, and goat anti-rabbit were all purchased from DAKO (ThermoFisher Scientific, Roskilde, Denmark). Phi29 DNA polymerase and PrestoBlue reagent were purchased from Thermo Fisher Scientific (Roskilde, Denmark). All chemicals, cells media, and media components were purchased from Sigma-Aldrich ApS (Søborg, Denmark). α³²P-dATP was purchased from PerkinElmer (Skovlunde, Denmark).