1 ethyl 3 3 dimethylaminopropyl carbodiimide edc

Aluminosilicate nanocomposites extracted from joss fly ash collected in a local Chinese temple in the Northern region of Malaysia. 1,1′-Carbonyldiimidazole (CDI), Tween-20 detergent, Tris-buffer, (3-Aminopropyl)triethoxysilane (APTES), phosphate-buffered saline (PBS), 1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), and N-hydroxysuccinimide (NHS) used for the surface enhancement of genosensor were procured from Sigma Aldrich, USA. Genomic sequences designed to detect EGFR mutation were purchased from Integrated DNA Technologies, USA. Carboxyl-terminated genome (5′ COOH-C6-CAGCAGTTTGGCCCGCCCAAAA 3′) was used as a probe for DNA immobilization. The complementary mutant strand (5′ TTTTGGGCGGGCCAAACTGCTG 3′), single base pair mismatch strand (5′ TTTTGGGCTGGCCAAACTGCTG 3′) and non-complementary strand (5′ CAGCAGTTTGGCCCGCCCAAAA 3′) were used as targets in the detection strategies^{20 (link)}.

The synthesis of thiolated HA (HS-HA) was prepared as described elsewhere [36 (link)]. Briefly, HA sodium salt (0.2 g, 0.5 mmol, Mw = 8–15 kDa, Carbosynth Limited, Berkshire, UK) was dissolved in 20 mL of water followed by the addition of 3,3′-dithiobis(propanoic hydrazide) (DTP) (0,238 g, 1.0 mmol, Frontier Scientific) while stirring. The pH of the mixture was adjusted to 4.75 with HCl (Merck). Next, 1-ethyl-3-[3-(dimethylamino)propyl]carbodiimide (EDC) (0.192 g, 1.0 mmol, Sigma-Aldrich) was added in solid form and the mixture stirred for 2.5 h. The reaction was stopped by increasing the pH to 7.0 with NaOH (Merck). Then, dithiothreitol (DTT) (1.0 g, 6.5 mmol, Acros) was added, the pH increased to 8.5, and the mixture was stirred (250 rpm) overnight. After decreasing the pH of the mixture to 3.5 with HCl, the reaction product was purified by dialysis (Mw cutoff = 2 kDa) against diluted HCl, pH = 3.5, and lyophilized for 48 h to yield HS-HA. The degree of substitution in HS-HA was determined by ¹H NMR (ratio between methylenes of DTP and N-acetyl methyl protons of HA) and by free thiol content as measured by an Ellman’s test.

Type I insoluble collagen prepared from bovine skin (Devro Plc), and chondroitin-6-sulphate (Bioiberica) were used to prepare collagen–GAG scaffolds. 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) and N-hydroxysuccinimide (NHS) were purchased from Sigma Aldrich. Human recombinant IGF-1 was purchased from R&D Systems. Human chondrocytes were derived from knee articular cartilage donated from patients (N = 3) undergoing total knee replacement surgery with full ethical consent 06/Q0108/213. Full depth articular cartilage was removed from femoral condyles and tibial plateaux using a scalpel. The tissue was then minced finely before incubating in a 0.2 % (w/v) solution of bacterial collagenase (Roche) in complete medium (DMEM, 10 % FCS plus antibiotics) overnight at 37 °C. Released cells were washed twice to remove any collagenase before plating on plastic. Chondrocytes were expanded and used at passage three in order to retain as much of the chondrogenic phenotype as possible. All experiments were carried out using cells derived from N = 3 individual donors.