Tricorn 5 50 column

IgG adsorption isotherms on the non‐grafted and CMD‐grafted protein A gels were determined in 20 mmol/L phosphate buffer at different pHs (pH 4.5, 7.4 or 10.0) and NaCl concentrations (0−150 mmol/L) as described by Yang et al. [18]. Saturated adsorption capacity (q_m, mg/g gel) and dissociation constant (K_d, mg/mL) of IgG were obtained by fitting the experimental data to Langmuir model as follows,
$q=\frac{q_{m}c}{K_d+c}.$
Dynamic binding capacities (DBC) for IgG onto the non‐grafted and CMD‐grafted protein A gel were measured in a Tricorn 5/50 column connected to an ÄKTA Start (GE Healthcare, Uppsala, Sweden). In the experiment, 100 mmol/L NaCl in 20 mmol/L phosphate buffer (pH 10.0) was applied as binding buffer, and the preparation of IgG solution. After the column was equilibrated with binding buffer, 0.5 mg/mL IgG solution was loaded at 0.5 mL/min. After IgG breakthrough, the column was washed with binding buffer to remove free protein and the adsorbed IgG was eluted by 0.01 mol/L glycine‐HCl buffer (pH 3.0). Finally, the column was regenerated by 0.1 mol/L NaOH for next experiments. DBC for IgG was calculated as follows,
$\mathrm{DBC}=\frac{c_0\left(V_{10}-V_0\right)}{V_{\mathrm{B}}}$ where V₁₀ and V_B are loading volume at 10% breakthrough and the column volume, respectively; V₀ is the dead volume measured with 2% acetone aqueous solution.

Cloning and purification procedures were performed as described in [12 (link)]. The HsdC (GCW_02350) coding sequence was amplified from the genomic DNA of M. gallisepticum S6 (forward primer: ATTAGGATCCATGTTTGATTATGCAAAGAAAATTA, reverse primer: TATAGTCGACATCATCTAATTTCATGCCAATCT, sequences for cloning are underlined). The amplicon was cloned into the pETm plasmid with C-terminal His-tag as described previously [12 (link)]. HsdC protein was produced in E. coli BL21-Gold (DE3) cells. Cells were grown overnight, harvested by centrifugation, washed in PBS and lysed with Branson 250 Sonifier (Branson) at 22 kHz for 10 min. The lysate was diluted with sample buffer (final concentrations of 20 mM Na₂HPO₄, 10 mM imidazole, 500 mM NaCl, pH 7.5). The protein was purified on a Tricorn 5/50 column (GE Healthcare) with Ni Sepharose High Performance (GE Healthcare) resin using the AKTA FPLC system (GE Healthcare). After the application of lysate, the column was washed with 25-ml aliquots of sample buffer, then with wash buffer (20 mM Na₂HPO₄, 25 mM imidazole, 500 mM NaCl, pH 7.5) and finally with elution buffer (20 mM Na₂HPO₄, 500 mM imidazole, 500 mM NaCl, pH 7.5). After elution, the protein was 60-fold diluted with 20 mM Tris-HCl buffer, pH 7.5 to 20 pmol/μl and directly used for electrophoretic mobility shift assay (EMSA).