Plv hu6 sgrna hubc dcas9 krab t2a gfp

pHR-SFFV-KRAB-dCas9-P2A-mCherry (Addgene #60954) was used to generate stable M07e expressing dCas9-KRAB fusion protein cell line. sgRNA library used in the screen was cloned into pU6-sgRNA-EF1Alpha-puro-T2A-BFP (Addgene #60955). The same vectors were used for screen validation or pLV-hU6-sgRNA-hUbC-dCas9-KRAB-T2a-GFP (Addgene #71237) was used. Sequence of clone sgRNA can be found in table S4. shRNAs targeting KIT, PDGFRA, or Renilla (table S5) were cloned into pLMP-Puro-IRES-GFP or pLMP-Puro-IRES-mCherry (gift from I. Aifantis, New York University).
Viral particles were produced in 293T cells by cotransfecting plasmids of interest along with a lentivirus packaging plasmid (psPAX2, Addgene #12260) and a vesicular stomatitis virus envelope expression plasmid (pMD2.G, Addgene #12259) or along with pCL-10A1 retrovirus packaging vector using calcium phosphate method. For transductions, cells were spinoculated twice with 293T supernatants harvested 24 and 48 hours after transfection and supplemented with polybrene (4 μg/ml) for 90 min at 2300 rpm and 30°C. Efficiency of knockdown was checked on homogeneous cell populations with respect to BFP, GFP, or mCherry expression after cell sorting or puromycin selection (1 μg/ml for 48 hours) by reverse transcription qPCR.

M-07e cells expressing sgRNA and dCas9-KRAB targeting the SE region 66 were produced using the following oligonucleotide sequences: SE_66_peak1_7FOR 5′ CACCGCTCTCGAGTGAGAAGTTGC 3′ SE_66_peak1_7REV 5′ AAACGCAACTTCTCACTCGAGAGC 3′. SgRNAs targeting Renilla (not present in the human genome) were used as a control. These oligonucleotides were synthesized (Sigma Aldrich), annealed, phosphorylated, and ligated into the linearized lentiviral vector pLV-hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP (Addgene #71237) upon BsmBI digestion.

A lentiviral expression vector was generated using a plasmid gifted by C. Gersbach (pLV hU6-sgRNA-hUbC-dCas9-KRAB-T2a-GFP; Addgene, #71237), in which the human U6, ubiquitin C promoter, and KRAB domain were replaced by synthetic fragments containing the mouse U6 promoter, guide RNA (gRNA) entry site, CAG promoter, and the ZIM3 repressor domain. Cross-species conservation of enhancer regions in mouse (mm9) and human (hg38) genomes was assessed using liftOver (69 (link)) and visually confirmed in datasets ENCFF118SVL and ENCFF656TFQ retrieved from the ENCODE portal (www.encodeproject.org/) (70 (link)). Two (FABP4 promoter) or three (FABP4 enhancer) sgRNAs were designed for each target site using CRISPOR v5.01 (http://crispor.tefor.net/), ordered as oligonucleotide pairs, annealed, and cloned into the expression vector via golden gate cloning with Esp 3I. A gRNA targeting a region of the lambda phage DNA without homology to mammalian genomes was used as a negative control. The gRNA sequences are provided in table S4.