Minelute gel purification kit

For all 13 samples (2°MEF, D2H, D5H, D8H, D11H, D16H, D18H, D16L, D21L, D21Ø, 1°iPSC, 2°iPSC and rtTA ESC), 5 mg of genomic DNA was mixed with 25 ng unmethylated cl857 Sam7 Lambda DNA (Promega, Madison, WI, USA). The DNA was fragmented by sonication to 300–500 bp with a Covaris S2 system (Covaris) followed by end repair with the End-It DNA End-Repair Kit (Epicenter). Paired-end universal library adaptors provided by Illumina were ligated to the sonicated DNA as per the manufacturer’s instructions for genomic DNA library construction. Ligated products were purified with AMPure XP beads (Beckman, Brea, CA, USA). Adaptor-ligated DNA was bisulfite-treated using the EpiTect Bisulfite Kit (QIAGEN) following the manufacturer’s instructions and then PCR-amplified using PfuTurboCx Hotstart DNA polymerase (Agilent, Santa Clara, CA, USA) with the following PCR conditions (2 min at 95 °C, 4 cycles of 15 s at 98 °C, 30 s at 60 °C, 4 min at 72 °C and then 10 min at 72 °C). The reaction products were purified using the MinElute gel purification kit (QIAGEN). The sodium bisulfite non-conversion rate was calculated as the percentage of cytosines sequenced at cytosine reference positions in the lambda genome.

After detailed live observations at high magnification (up to 1,200×), specimens matching in similar‐sized loricae with a flared and annulated collar, a conspicuous distance between the collar membranelles and the ciliary fields, and an extension of the undisturbed cells far beyond the lorica rim were picked from material sampled in the Indian River and preserved in 80% ethanol; no similar tintinnid species that could have been confused occurred.
The DNA was extracted from the cells, using the DNEasy Blood and Tissue kit (Qiagen, Mississauga, ON, Canada) according to the manufacturer's protocol, with the exception that cells were lysed for 30 min and only 100 μl of buffer AE was used for elution. Amplification of the small subunit ribosomal RNA (SSU rRNA) gene with primers 300F (5′‐AGGGTTCGATTCCGGAG‐3′; Elwood et al. 1985) and Reverse B (5′‐TGATCCTTCTGCAGGTTCACCTAC‐3′; Medlin et al. 1988) followed a standard PCR protocol, and the amplified product was purified with the MinElute Gel purification kit (Qiagen). Finally, the SSU rRNA gene was sequenced in both directions with a 3730 DNA Analyzer (Applied Biosystems, Burlington, ON), using the amplification primers plus two internal primers (690F and 690R; Elwood et al. 1985).

DNA from four independent chromatin immunoprecipitations was pooled for each factor and was run on a 2% agarose gel, as described previously (22 (link)), to isolate fragments between 100 and 500 bp using Qiagen’s MinElute gel purification kit. More than 5 ng of DNA for each sample was sent to the Harvard Biopolymers facility for sequencing after library construction (Illumina HiSeq 2500, 50 bp single reads). The same was done from the relevant input controls, which were non-precipitated chromatin from all chromatin immunoprecipitations pooled together.

RNA-seq libraries for the studies of aub were generated by Weill Cornell Epigenomics Core according to the protocol of [61 (link)]. Briefly, total RNA was extracted from the same ovaries as above, and mRNAs were isolated using poly-T Dynabeads (Invitrogen) according to the manufacturer’s instructions. Isolated mRNAs were further fragmented using fragmentation buffer (Ambion), ethanol precipitated, and reverse transcribed using Superscript II (Invitrogen) and random hexamer primers. Second-strand synthesis was performed using DNA polymerase I (Promega). cDNA was purified on a MinElute column (Qiagen), repaired with End-IT DNA repair kit (Epicentre), A-tailed with Klenow enzyme (New England Biolabs), and ligated to Illumina adaptors. Ligated cDNA was gel purified with the MinElute gel purification kit (Qiagen), PCR amplified, and gel purified again to make libraries.
RNA-seq libraries for the studies of spn-E and armi were prepared by using TruSeq Stranded Total RNA Library Preparation Kit for Illumina. 50 bp reads from each library were sequenced on a HiSeq 2000 (Aub and Spn-E) and a HiSeq 2500 (Armi) by the Weill-Cornell Epigenomics Core. RNA-seq and small RNA-seq data sets are deposited under PRJNA494103.

A 50 μl PCR reaction contained the following: 1 ng template DNA, 1× Taq buffer, 0.2 mM dNTPs‐dTTP, 0.2 mM dUTP, 0.4 μM forward and reverse oligos, and 1 U Hot Taq polymerase. Thermal cycler conditions are as follows: 98°C for 30 s, 25 cycles of 98°C for 15 s, 60°C for 30 s, and 72°C for 1 min. A final extension was performed at 72°C for 5 min. Uracilated amplicon was gel‐purified using the Minelute gel purification kit (Qiagen).