3500xl genetic analyser

Genomic DNA of iPSCs was extracted by PureLink Genomic DNA Mini Kit (Thermo Fisher Scientific) and amplified by PCR using PrimeSTAR GXL DNA Polymerase (TaKaRa Bio, Shiga, Japan) and Veriti thermal cycler (Thermo Fisher Scientific). The thermal conditions for PCR were 30 cycles of 10 s at 98°C, 15 s at 60°C and 1 min at 68°C. The amplified PCR products were extracted from agarose gel by PureLink Quick Gel Extraction Kit (Thermo Fisher Scientific). Sequencing analysis was done by 3500 xL Genetic analyser (Thermo Fisher Scientific). Forward (F) and reverse (R) PCR primers were as follows: F, 5′‐tgaccaggtgttgtgctagg‐3′, R, 5′‐ccgacttggggaggtttcg‐3′.

All strains were cultured on Trypticase Soy Agar with 5% Sheep Blood (bioMérieux, Marcy l’Étoile, France), and one colony was subcultured on the same agar medium for further analysis. DNA extraction was performed as previously described (Predari et al., 1991 (link)). The amplification of the seven housekeeping genes included in the MLST scheme for S. aureus was performed as previously described (Enright et al., 2000 (link); Crisóstomo et al., 2001 (link)). Sequencing was done on a 3500xL Genetic Analyser (Thermo Fisher Scientific Waltham, Massachusetts, United States), and sequence analysis was performed using SeqScape Software v3.0™ from the same company. The sequence type (ST) was determined for each strain via the PubMLST database (Jolley et al., 2018 (link))¹ or after whole-genome sequencing (wgMLST).

Sampling was conducted by applying a wet-dry swabbing technique using viscose swabs (Forensic Swab L, Sarstedt, Nümbrecht, Germany). Upon collection, wet and dry swabs were returned to their respective tube bases, which contained a ventilation membrane for self-drying, and placed into a labelled envelope for storage. Air-dried swab tips were excised and placed into tubes (wet/dry swabs constituted one sample) and stored at −20 °C until the commencement of DNA analysis. DNA was extracted using the DNA IQ system (Promega, Madison, WI, USA) to a final volume of 60 μL and quantified with Quantifiler^® Trio DNA Quantifiler Kit on an ABIPRISM^® 7500 (Life Technologies, Carlsbad, CA, USA) and interpreted using HID software. Amplification was carried out using the PowerPlex^®21 system (Promega, Madison, WI, USA) for 30 cycles using 0.5 ng of template DNA, or, if the sample concentration was below 0.033 ng/μL,15 μL of the sample was used. Amplified product detection and sizing was performed on a 3500 xL Genetic Analyser (Life Technologies, Carlsbad, CA, USA) with an injection voltage of 1.2 kV and an injection time of 24 s. GeneMapper^® ID-X software (v1.5, Life Technologies, Carlsbad, CA, USA) was used for genotyping, with an analytical threshold of 175 RFU, as per laboratory protocol.