All animal experiments were performed according to the approved protocols of the Animal Care and Use Committee at Jilin University. And this experiment study was approved by the Ethics Committee of Jilin University (ethical approval number: 20200063). SIRT1flox/flox mice and CreERT2 mice were purchased from Jackson. 8-week-old male C57BL/6 mice were purchased from Viton Lihua. According to the methods given in the references, 8-week-old male C57BL/6 mice and transgenic mice swam in water pool (50 cm in diameter), starting with 10 minutes and increase by 10 minutes a day to 90 minutes, twice a day, approximately 6 h apart.3 (link),31 (link) MI/R surgery was performed on mice at the end of 21 days swimming training. At the endpoint of each experiment, mice ventricular tissues were harvested and frozen or for frozen section preparation for subsequent analysis.
Sirt1flox flox mice
Manufactured by Jackson ImmunoResearch
Sourced in United Kingdom, China
The Sirt1flox/flox mice are a genetically modified mouse line that has the Sirt1 gene flanked by loxP sites. This allows for the conditional deletion of the Sirt1 gene in a tissue-specific or inducible manner using Cre recombinase technology.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy minelute cleanup kit, by Qiagen (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Tissue tearor homogenizer, by Avantor (1 mentions)
Sm22αcre mice, by Jackson ImmunoResearch (1 mentions)
Cre ert2, by Jackson ImmunoResearch (1 mentions)
Wild type c57bl 6j mice, by Jackson ImmunoResearch (1 mentions)
C57bl 6j mice, by Jackson ImmunoResearch (1 mentions)
9 protocols using sirt1flox flox mice
1
Swim Training and Myocardial Infarction in Mice
2
Cardiac-Specific Sirt1 Knockout Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6 and 1,29Sv mixed background Sirt1flox/flox mice were obtained from Jackson Laboratory. Cardiac-specific (α-myosin heavy chain promoter-driven) Cre transgenic mice with C57BL/6 background, αMHC-Cre, were obtained from Dr Michael D. Schneider. Cardiac-specific Sirt1 knockout mice were generated by crossing αMHC-Cre with Sirt1flox/flox mice.
3
Cardiac Metabolism Regulation by Nampt and Sirt1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Systemic Nampt heterozygous knockout (Nampt +/−) mice were provided by Dr. S. Yamanaka (Kyoto University, Japan). Cardiac-specific Sirt1 knockout (Sirt1KO) mice were generated by crossing Sirt1flox/flox mice (Jackson Laboratory) with C57BL/6J background and α-myosin heavy chain promoter–driven Cre mice (αMHC-Cre, courtesy of Dr. M. Schneider, Imperial College, London, UK) as described previously [13] (link). All Sirt1flox/flox (control) and Sirt1flox/flox, αMHC-Cre (Sirt1KO) mice were backcrossed to C57BL/6J background. Transgenic mice with cardiac-specific expression of mRFP-GFP-LC3 have been described [15] . All animal protocols were approved by the Institutional Animal Care and Use Committee of Rutgers New Jersey Medical School.
4
Resveratrol Feeding Regimen in Aged Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All mice were housed under controlled temperature (25 ± 1°C) and lighting conditions and fed standard chow unless otherwise indicated. Sirt1flox/flox mice were obtained from Jackson Laboratory. All mice were cared for in accordance with the MIT Committee on Animal Care (MITCAC) which approved this study.
For resveratrol feeding experiments, 12 month old male C57BL/6J mice were fed 400mg/kg/day resveratrol or vehicle control in standard chow. After four months, mice were euthanized via carbon dioxide asphyxiation as approved by MITCAC and the calvaria (top of the skull) isolated, washed extensively to remove non-osseous tissue and flash-frozen in liquid nitrogen. For RNA isolation, calvaria was minced in Trizol (Thermo Fisher), and thoroughly homogenized using a Tissue Tearor homogenizer (VWR). Lysates were then spun down at 15,000g for 10 minutes, with the resulting supernatant used for RNA isolation using the RNeasy MinElute Cleanup kit (Qiagen).
For resveratrol feeding experiments, 12 month old male C57BL/6J mice were fed 400mg/kg/day resveratrol or vehicle control in standard chow. After four months, mice were euthanized via carbon dioxide asphyxiation as approved by MITCAC and the calvaria (top of the skull) isolated, washed extensively to remove non-osseous tissue and flash-frozen in liquid nitrogen. For RNA isolation, calvaria was minced in Trizol (Thermo Fisher), and thoroughly homogenized using a Tissue Tearor homogenizer (VWR). Lysates were then spun down at 15,000g for 10 minutes, with the resulting supernatant used for RNA isolation using the RNeasy MinElute Cleanup kit (Qiagen).
5
Generating SIRT1 Knockdown Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All animals were housed in a temperature-controlled room (23 °C) with a 12:12 light: dark cycle.
SIRT1 knockdown mice (SIRT1+/−) (HE) were generated by crossbreeding SIRT1flox/flox (WT) mice with broad-expression Cre transgenic mice. The Cre transgenic mice were provided by the Shanghai Model Organisms Center (Shanghai, China), while the SIRT1flox/flox mice were purchased from the Jackson Lab (029603, the Jackson Laboratory, Farmington, CT, USA). Successful knockdown of SIRT1 in mice was confirmed with PCR and immunofluorescence.
The PCR cycling conditions for SIRT1 were a primary denaturation at 94 °C for 3 min, followed by 35 cycles of 30 s at 94 °C, annealing temperature at 60 °C for 30 s, and 72 °C for 60 s, with a final extension of 5 min at 72 °C. Primer sequences for PCR were as follows: Cre: forward AGGCGGATTTCTGAGTTCGA and reverse CGTCCCTTGTAATGTTTCCC and floxed SIRT1 gene: forward AGGAATCCCACAGGAGACAG and reverse GGTTAAGATTAGCCCATTAAAGC.
SIRT1+/− female mice at 8 weeks of age were individually mated with SIRT1+/− male mice. The initiation of pregnancy was marked by the presence of postcoital vaginal plug at gestation day (GD) 0.5 for early pregnancy study.
SIRT1 knockdown mice (SIRT1+/−) (HE) were generated by crossbreeding SIRT1flox/flox (WT) mice with broad-expression Cre transgenic mice. The Cre transgenic mice were provided by the Shanghai Model Organisms Center (Shanghai, China), while the SIRT1flox/flox mice were purchased from the Jackson Lab (029603, the Jackson Laboratory, Farmington, CT, USA). Successful knockdown of SIRT1 in mice was confirmed with PCR and immunofluorescence.
The PCR cycling conditions for SIRT1 were a primary denaturation at 94 °C for 3 min, followed by 35 cycles of 30 s at 94 °C, annealing temperature at 60 °C for 30 s, and 72 °C for 60 s, with a final extension of 5 min at 72 °C. Primer sequences for PCR were as follows: Cre: forward AGGCGGATTTCTGAGTTCGA and reverse CGTCCCTTGTAATGTTTCCC and floxed SIRT1 gene: forward AGGAATCCCACAGGAGACAG and reverse GGTTAAGATTAGCCCATTAAAGC.
SIRT1+/− female mice at 8 weeks of age were individually mated with SIRT1+/− male mice. The initiation of pregnancy was marked by the presence of postcoital vaginal plug at gestation day (GD) 0.5 for early pregnancy study.
6
Heart-specific Sirt1 knockout mouse model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Animal experiments were all conducted with the approval of the Institutional Animal Care and Use Committee (IACUC, permit No. 19-364) of the National Defense Medical Center (Taipei, Taiwan) and in accordance with the National Institutes of Health guidelines, “Guide for the Care and Use of Laboratory Animals”, on manipulations with experimental animals. The study was carried out in compliance with the ARRIVE guidelines.
The mice with the heart-specific Sirt1 exon-4 knockout (Sirt1−/−) were created by crossing Sirt1flox/flox mice (controls purchased from Jackson Laboratory) with mice carrying α-MHC (myosin heavy chain) promoter–driven Cre in a C57BL/6J background (α-MHC-Cre mice, courtesy of Prof. M. Schneider, Imperial College London) and are currently in use in the laboratory [13 (link)]. Six-week-old mice were separately fed either a standard diet (SD) (10% kcal fat, D17071303i, Research Diets, New Brunswick, NJ, USA) or a palmitate-enriched HFD (60% kcal fat, D16042106i, Research Diets, New Brunswick, NJ, USA) for 8 weeks and then were euthanized to collect the hearts for subsequent experiments. The animals were kept at a temperature of 21 ± 1 °C on a controlled 12:12 h light-dark cycle with ad libitum access to deionized drinking water before the experiments.
The mice with the heart-specific Sirt1 exon-4 knockout (Sirt1−/−) were created by crossing Sirt1flox/flox mice (controls purchased from Jackson Laboratory) with mice carrying α-MHC (myosin heavy chain) promoter–driven Cre in a C57BL/6J background (α-MHC-Cre mice, courtesy of Prof. M. Schneider, Imperial College London) and are currently in use in the laboratory [13 (link)]. Six-week-old mice were separately fed either a standard diet (SD) (10% kcal fat, D17071303i, Research Diets, New Brunswick, NJ, USA) or a palmitate-enriched HFD (60% kcal fat, D16042106i, Research Diets, New Brunswick, NJ, USA) for 8 weeks and then were euthanized to collect the hearts for subsequent experiments. The animals were kept at a temperature of 21 ± 1 °C on a controlled 12:12 h light-dark cycle with ad libitum access to deionized drinking water before the experiments.
7
Generating SVKO;Apoe−/− Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Apoe−/− mice on C57BL/6J background were obtained from Peking University. We established SVKO mice using a Cre/LoxP strategy. Sirt1flox/flox mice that expressed SIRT1exon4 flanked by LoxP sites on the 129 background were purchased from The Jackson Laboratory (stock no. 008041). SM22α-Cre+/+ mice on the 129 background with a Cre-recombinase gene inserted into the endogenous transgelin (SM22α) locus were purchased from The Jackson Laboratory (stock no. 006878). These mice were backcrossed with mice on the C57BL/6J background for at least 10 generations to yield Sirt1flox/flox mice and SM22α-Cre+/− mice on the C57BL/6J background. They were further crossed with Apoe−/− mice to generate Sirt1flox/flox;Apoe−/− and SM22α-Cre+/−;Apoe−/− mice. Male SM22α-Cre+/−;Sirt1flox/flox;Apoe−/− mice were crossed with female Sirt1flox/flox;Apoe−/− mice, both on the C57BL/6J background, to generate SVKO;Apoe−/− mice (SM22α-Cre+/−;Sirt1flox/flox;Apoe−/−). All of the mice were genotyped by PCR using tail clip samples. The primers used for genotyping are listed in Table S1. All of the animal protocols were approved by the Animal Care and Use Committee at the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, and Peking Union Medical College.
8
Inducible Cardiac-Specific SIRT1 and PDH E1α Knockout Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6 J wild type mice (4–6months), SIRT1flox/flox mice (stock number 008041), and CreERT2 (stock number 005657) mice were from Jackson Laboratory. Cardiomyocyte specific deletion of the SIRT1 gene mouse was generated by breeding SIRT1flox/flox mice with transgenic mice that carried an autosomally integrated Cre gene driven by the cardiac-specific alpha-myosin heavy chain promoter (αMHC) (CreERT2). The inducible cardiac-specific SIRT1 knockout (icSIRT1 KO) mice were generated by Tamoxifen injection (0.04 mg/g, i.p. 5 days) of CreERT2-SIRT1flox/flox (12 weeks old) mice, and SIRT1flox/flox mice (12 weeks old) with Tamoxifen injection were used for control groups. Cardiac-specific deletion of the PDHa1 gene was also generated by breeding PDH E1αflox/flox mice [37 ] with transgenic mice that carried an autosomally integrated Cre gene driven by the cardiac-specific aMHC (CreERT2). The inducible cardiac-specific PDH E1α knockout (icPDH E1α KO) mice were generated by Tamoxifen injection (0.04 mg/g, ip 5 days), and PDH E1αflox/flox (12 weeks old) mice with Tamoxifen injection were used for control groups. The genotying details were described in the Supplementary material online. All animal experiments were performed in compliance with NIH guidelines. And All animal protocols in this study were approved by the University of South Florida Institutional Animal Care and Use Committee.
9
Cardiac-Specific SIRT1 Knockout Mouse Model
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!