Real-time qPCR (RT-qPCR) was used to determine the levels of Hotairm1 in exosomes, Gr1+CD11b+ cells, or S100A9 immunoprecipitates. Exosomes were purified from plasma or cell culture supernatants, and exosomal RNA was isolated using exoRNeasy Starter Kit (Qiagen). Total cellular RNA was isolated from Gr1+CD11b+ cells using TRIzol reagent (Invitrogen). Levels of Hotairm1 expression were measured using QuantiTect PCR Mastermix and RT2 lncRNAqPCR Assay primers (Qiagen). The expression level was calculated using the 2−ΔΔCt cycle threshold method. Values were normalized to GAPDH RNA for total RNA or 18S RNA for exosomal RNA, amplified with QuantiTect Primer Assays. The PCR was performed in duplicate.
Quantitect pcr mastermix
Manufactured by Qiagen
The QuantiTect PCR Mastermix is a ready-to-use solution for quantitative real-time PCR. It contains all the necessary components, including a DNA polymerase, buffer, and dNTPs, to perform real-time PCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
Abi prism 7000 sequence detection system, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Rt2 lncrnaqpcr assay, by Qiagen (2 mentions)
Exorneasy starter kit, by Qiagen (2 mentions)
Superscript reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Sybr green master mix kit, by Thermo Fisher Scientific (2 mentions)
Amaxa basic nucleofector kit, by Lonza (2 mentions)
Amaxa nucleofactor apparatus, by Lonza (2 mentions)
Rna stat 60, by Tel-Test (2 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
Nuclisens easymag instrument, by bioMérieux (1 mentions)
5 protocols using quantitect pcr mastermix
1
Quantifying Hotairm1 in Exosomes and Cells
2
Quantifying Hotairm1 in Exosomes and Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time qPCR (RT-qPCR) was used to determine the levels of Hotairm1 in exosomes, Gr1+CD11b+ cells, or S100A9 immunoprecipitates. Exosomes were purified from plasma or cell culture supernatants, and exosomal RNA was isolated using exoRNeasy Starter Kit (Qiagen). Total cellular RNA was isolated from Gr1+CD11b+ cells using TRIzol reagent (Invitrogen). Levels of Hotairm1 expression were measured using QuantiTect PCR Mastermix and RT2 lncRNAqPCR Assay primers (Qiagen). The expression level was calculated using the 2−ΔΔCt cycle threshold method. Values were normalized to GAPDH RNA for total RNA or 18S RNA for exosomal RNA, amplified with QuantiTect Primer Assays. The PCR was performed in duplicate.
3
Quantitative PCR for CMV and eGFP Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers and probes were designed to amplify products specific for RhCMV 68–1 glycoprotein B (F:5’CACGGTTTTCTCCAAAATGC3’ , R:5’GACTTCTGATGGTAAAGTTGTGGA3’ , P:FAM-ATT GTTAGATCCATTGTAAAAAGGAGA-TAMRA ), CyCMV glycoprotein B (F:5’CACCAAAATGTTTTCCGTTG3’ , R:5’ATCGTCTGGTGATGTGGTG3’ , P:FAM-CTGCCGTTGTAAAAGGGAGAT–TAMRA ), and eGFP (F:5’ AACTACAACAGCCACAACGTCT3’ , R:5’CGGATCTTGAAGTTCACCTTGAT3’ , P:FAM-TATCATGGCCGACAAGCAGAAGAACG-TAMRA ). DNA was extracted from whole blood, plasma, whole urine, urine pellet, saliva pellet and BAL pellet using a NucliSENS easyMAG instrument (bioMerieux) as per manufacturer’s protocol. Tissue culture-derived urine and lymph node biopsy DNA was extracted using DNeasy Blood and Tissue Kit (Qiagen) as per manufacturer’s protocol. Each reaction consisted of 2X QuantiTect PCR mastermix (Qiagen), primers (400 nM final each), probe (100 nM final), 5 μl of extracted DNA and water to a final volume of 50 μl. The real-time qPCR was run on an ABI Prism 7000 Sequence Detection System (Applied Biosystems) and the conditions were as follows: 1 cycle at 95°C for 10 minutes followed by 50 cycles at 95°C for 15 seconds and 60°C for 1 minute. Serial dilutions of the standard curve plasmid were prepared to quantitate the number of copies/ml and the results were analysed using SDS v1.2 software.
4
Knockdown of ErbB and Nardilysin in Neural Stem Cells
5
Knockdown of ErbB and Nardilysin in Neural Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Neurospheres were mechanically dissociated into single cells and transfected with 200 nM of siRNA designed to knock down mouse ErbB-1, ErbB-2, ErbB-3, ErbB-4 or Nardilysin genes, or with scrambled siRNA (all from Ambion, Carlsbad, CA) using Amaxa Basic Nucleofector kit (Lonza, Allendale, NJ) and the Amaxa Nucleofactor™ apparatus (Lonza, Allendale, NJ). siRNA suppression efficiency and plasmid transfection efficiency were determined by real-time PCR as follows. Total RNA from NSC was extracted using RNA STAT-60 (TEL-TEST, Friendswoods, TX) according to the manufacturer’s protocol. Aliquots of 1μg of total RNA were reverse transcribed using SuperScript Reverse Transcriptase (Invitrogen, Carlsbad, CA) and oligo-dT(18 (link))-primers (Invitrogen, Carlsbad, CA). RT-PCR amplification was performed in a 25 μl reaction containing 150 ng cDNA, 12.5 μl 2X QuantiTect PCR Master Mix (Qiagen, Valencia, CA), and 1 μl of 10 nM primers (Integrated DNA Technologies, Skokie, IL). The primers used are shown in Table 1 . The real-time PCR reaction was performed using the SYBR Green Master Mix kit and the ABI Prism 7000 Sequence Detection System (Applied Biosystems, Forster City, CA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified as an internal control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!