Anti normal rabbit igg

We conducted a ChIP assay in Flag-FXR-overexpressing LX2 cells using a simple ChIP enzymatic chromatin IP kit (Cell Signaling) according to the manufacturer’s protocol. qPCR was utilized to verify the presence of FXR-binding region in the NLRP3 promoter. The following qPCR primer sequences were used: (1) forward, 5ʹ-TGGGATTACAGGCGTGAG − 3ʹ and reverse, 5ʹ-CTGGGTGACAAGAGCAAGAC − 3ʹ; (2) forward, 5ʹ-TGAGTCAATGAGTCAGGGAG − 3ʹ and reverse, 5ʹ- GAGGGAAGTGAAACTAAGGA − 3ʹ. The antibodies included anti-normal rabbit IgG (Cell Signaling Technology, #2729) and anti-Flag (Cell Signaling Technology, #14793).

ChIP analysis was performed using the SimpleChIP Plus Enzymatic Chromatin IP Kit (Magnetic Beads) (#38191S, Cell Signaling) following the manufacturer's protocol. An approximate amount of 4 × 10⁶ cells was included in each ChIP reaction mixture. The cells underwent crosslinking with 1% formaldehyde at room temperature for 10 minutes, followed by glycine neutralization for 5 min. Subsequent steps involved resuspending the cells, digesting the chromatin with Micrococcal Nuclease, and sonication to obtain suitable DNA fragments. Dilution of the chromatin complexes occurred in ChIP dilution buffer, and immunoprecipitation was performed using these antibodies: anti-BRD4 (#ab243862, Abcam), anti-MED1 (#ab60950, Abcam), anti-H3K27Ac (#ab4729, Abcam), anti-normal rabbit IgG (#2729S, Cell Signaling), and anti-HA Tag (#66,006–2-lg, Proteintech). Elution of the chromatin from the antibody/protein G magnetic beads utilized ChIP elution buffer and was later transferred to a centrifugation column for DNA purification. Measurement of the immunoprecipitated DNA samples was done through qPCR. The resulting data were presented as a percentage of input DNA. For ChIP-qPCR primer sequences, please refer to  Additional file 1: Table S2.

Chemicals were obtained from the following sources: cis-Diammineplatinum (II) dichloride (CDDP), N-acetylcysteine (NAC) and MG132 were purchased from Sigma-Aldrich (St. Louis, MO, USA). Antibodies were obtained from the following sources: anti-AKT (#9272 for western blot), anti-AKT (#2920 for proximity ligation assay, PLA), anti-p-AKT (Ser473), anti-Myc, anti-His, anti-FOXO1, anti-FOXO3, anti-FOXO4, anti-GAPDH, anti-Normal Rabbit IgG, horseradish peroxidase (HRP)-conjugated anti-mouse IgG and anti-rabbit IgG (Cell signaling Technology, Beverly, MA, USA), anti-K48 Ubiquitin, anti-K63 Ubiquitin, anti-α-Tubulin (Millipore, Temecula, CA, USA), anti-HA for western blot, anti-GFP (Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-MUL1, anti-Lamin A and anti-HA for ChIP assay (abcam, Cambridge, MA, USA), anti-hemagglutinin (HA), anti-GFP (Santa Cruz, Biotechnology, Santa Cruz, CA, USA), anti-Flag (Sigma-Aldrich), Alexa Flour 488-conjugated goat anti-Mouse and Alexa Flour 546-conjugated goat anti-Rabbit (Invitrogen, Carlsbad, CA, USA)

Anti-UHRF1 (A2343), Anti-β-Tubulin (A12289), Anti-NCAM1 (A7913), Anti-Synaptophysin (A6344), Anti-USP7 (A13564), Anti-BTRC (A18232) were purchased from ABclonal (Wuhan,HuBei, China). Anti-Cleaved-PARP, Anti-AKT (phospho S473) were purchased from Abcam (Cambirdge,MA,USA). Anti- Akt (pan) (#4685), Anti-HA Tag (#3724), Anti-p21(#2947), Anti-Phospho-AKT (Thr308) (#13038), Anti-Normal Rabbit IgG (#2729) were purchased from Cell Signaling Technology(Danvers, MA, USA), Anti-AKT1 antibody [HL1145] (#GTX636416) was purchased from GenTex (Irvine, CA, USA), Anti-His Tag(A00186) was purchased from GenScript (Nanjing, Jiangsu, China), p-Thr(H-2) was purchased from Santa Cruze Biotechnology(Shanghai, China). Monoclonal ANTI-Flag® M2 antibody (F1804) and Normal Mouse IgG (12-371) were purchased from Merck (Darmstadt, Germany).
Cycloheximide (HY-12320), MK2206 (HY-108232), and Protein A/G Magnetic Beads (HY-K0202) were purchased from MedChemExpress LLC. (Shanghai, China). MG132 (T2154) was purchased from Topscience Co. Ltd. (Shanghai, China). Lipo6000™ Transfection Reagent(C0526), a cationic liposome for transfection of HEK293T cells, was purchased from Beyotime (Shanghai, China).

The regular chromatin preparation was performed as described^{50 (link)}. In brief, cells were cross-linked with 1% formaldehyde solution for 10 min and quenched with 0.125 M glycine. For H3R8me2a ChIP, the cell pellets were resuspended in cold CSK buffer (100 mM NaCl, 300 mM sucrose, 3 mM MgCl₂, 10 mM PIPES, pH 6.8) containing Triton X-100 (0.5%) and EGTA (1 mM) before 10 min of fixation in 0.5% Formaldehyde solution. After being quenched by 0.125 M Glycine, cells were spun down, washed, resuspended, lysed, and ultra-sonicated for 25 min with 30 s ultra-sonication at 30 s intervals (Bioruptor pico, Diagenode, Belgium). The resulting fragmented chromatin extract was precleared with Protein A/G beads (ThermoFisher, Beijing, China) and then incubated overnight with antibodies: anti-H3K4me1, anti-H3K4me3, anti-3K27me3, anti-H3K9me3 (Cell Signaling Technology), anti-H3K27ac (Abcam), anti-H3R8me2a (Novus Biologicals), and Normal anti-rabbit IgG (Cell Signaling Technology) as controls. After stringent washes, elution, and reverse cross-linking, DNA was purified using PCR purification kits (QIAGEN, Hilden, Germany). The primers for ChIP-qPCR analyses at the promoters and enhancers are listed in Supplementary Table 2.