A real time pcr system

Manufactured by Bio-Rad

The real-time PCR system is a laboratory instrument used for the amplification and detection of specific DNA sequences in real-time. It provides accurate and sensitive quantification of target DNA or RNA molecules during the PCR (Polymerase Chain Reaction) process.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (2 mentions) Random primer, by Thermo Fisher Scientific (1 mentions) Superscript 3, by Thermo Fisher Scientific (1 mentions) Sybr green supermix, by Bio-Rad (1 mentions) Sybr green mix, by Merck Group (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Moloney murine leukemia virus reverse transcriptase, by Promega (1 mentions)

2 protocols using a real time pcr system

Extraction and Quantification of Mouse Liver RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from the mouse liver was extracted using TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. RNA was reverse transcribed into cDNA with SuperScript III (Thermo Fisher Scientific) and random primers (Thermo Fisher Scientific). The abundance of transcripts was measured by a real-time PCR system (Bio-Rad) using SYBR Green Supermix (Bio-Rad). The relative expression for each gene of interest was normalized with the internal control, 18S. The primer sequences are shown in Table S11.

Fan Y., Wolford B.N., Lu H., Liang W., Sun J., Zhou W., Rom O., Mahajan A., Surakka I., Graham S.E., Liu Z., Kim H., Ramdas S., Fritsche L.G., Nielsen J.B., Gabrielsen M.E., Hveem K., Yang D., Song J., Garcia-Barrio M.T., Zhang J., Liu W., Zhang K., Willer C.J, & Chen Y.E. (2021). Type 2 diabetes sex-specific effects associated with E167K coding variant in TM6SF2. iScience, 24(11), 103196.

+ Open protocol

+ Expand

Imaginal Disc RNA Isolation and RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Imaginal disc tissues (including brain) were dissected and total RNA was isolated using TRIzol (Invitrogen) for RT-PCR. Total RNA (2 μg) was reverse-transcribed using Moloney murine leukemia virus reverse transcriptase (Promega) and random primers following the protocol of the manufacturer. PCR was performed in triplicate using SYBR Green Mix (Sigma) and a real-time PCR system (Bio-Rad). The Primer sequences were: tefu(F): GGGATTCGATAAACTGGC; tefu(R): AAAGGCAGCAGGCAGGTC; Rad50(F): CGGAGTTTCGGCACCTATG; Rad50(R): TCTTTCCGCATCCGTTCTC; Rp49(F) ACAGGCCCAAGATCGTGAAGA; and Rp49(R) CGCACTCTGTTGTCGATACCCT.

Pei X., Du E., Sheng Z, & Du W. (2020). Rb family-independent activating E2F increases genome stability, promotes Homologous Recombination, and decreases Non-Homologous End Joining. Mechanisms of development, 162, 103607.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!