Facsmelody sorter

For the CRISPR/Cas9-mediated genomic deletions in the IGF2BP1 and METTL3 loci, A549 cells were transfected with two CRISPR sgRNA-encoding plasmids (IGF2BP1: psg_RFP_IGF2BP1_Ex6, psg_RFP_IGF2BP1_Ex7; METTL3: psg_RFP_METTL3_Ex3–1, psg_RFP_METTL3_Ex3–2) and a Cas9 nuclease-encoding plasmids (pcDNA_Cas9_T2A_GFP). For the genomic deletion of the E2F1 3′UTR locus, PANC-1 cells were transfected with two CRISPR sgRNA-encoding (psg_RFP_E2F1_3p1, psg_RFP_E2F1_3p2, encoding sgRNAs targeting the last exon of E2F1 downstream of the stop-codon and upstream of the polyA-signal) and a Cas9 nuclease-encoding plasmids (pcDNA_Cas9_T2A_GFP). Single cell clones were generated by seeding one RFP- and GFP-positive cell per well using a FACS Melody sorter (BD Bioscience) 48 h post-transfection. The deletion of IGF2BP1 and METTL3 was validated by western blotting. The bi-allelic deletion of the E2F1 3′UTR in the E2F1 gene locus was validated by PCR on isolated genomic DNA of single cell clones. CRISPR sgRNAs, plasmids and PCR primer are summarized in Supplementary Table S10.

Epitope-specific CD8⁺ T cell lines were generated by sorting dextramer-positive cells (FACSMelody sorter (BD)) from HLA-B*0702- and HLA-A*0101-positive mumps patients and subsequently further expanded as described above for effector CD8 + T cell lines.

Genomic deletions in the MIR21 locus by CRISPR/Cas9 were achieved by transfection of two sgRNA-encoding plasmids (psg_RFP_miR-21_for, psg_RFP_miR-21-rev, expressing RFP) and the Cas9-encoding plasmid (pcDNA_Cas9-T2A-GFP, expressing GFP). Forty-eight hours post-transfection, single RFP- and GFP-positive cells were seeded by using a FACS Melody sorter (BD Biosciences). The deletion of ∼200 nt in the locus was verified by PCR on isolated gDNA of single-cell clones and sequencing of amplicons. Plasmids and PCR primer are summarized in Supplementary Table S9.

Alanine mutation of Sox2 T258 in E14 cells was performed as described previously²⁷ with some modifications. A guide RNA sequence near T258 (TTACCTCTTCCTCCCACTCC) was inserted into the PX458 vector (#48138; Addgene, USA), which was then named PX458-gSox2^T258. As a donor, single-stranded DNA (120 bp, CTCCATGGGCTCTGTGGTCAAGTCCGAGGCCAGCTCCAGC CCCCCCGTGGTTGCCTCTTCCTCCCACTCCAGAGCGCCCTGCCAGGCCGGGGACCTCCGGGACATGATCAGCATGTACCT) was synthesized at Macrogen (Seoul, Korea). At 3 days after transfection of PX458-gSox2^T258 and donor single-stranded DNA into E14 cells using Lipofectamine 2000, GFP-positive cells were sorted using a FACSMelody sorter (BD Biosciences, USA) at the Flow Cytometry Core Facility (National Cancer Center). Individual cells were left to proliferate in a 96-well culture plate in the presence of 2i (PD0325901 and CHIR99021)^{13 (link)}, and clones with alanine mutations were selected using genomic DNA sequencing. The selected clones were normally maintained in serum with LIF and 2i. Cells at passages 1–10 after removal of 2i were used for the experiments. The following primers were used to confirm the presence of the T258A mutant: forward, 5′-CCTACATGAACGGCTCGCCC-3′; reverse, 5′-CTCCTCTTTTTGCACCCCTCC-3′.

For cell cycle analyses, cells were harvested with trypsin (72 h post-transfection or otherwise indicated), fixed overnight in 70% ethanol at −20°C. DNA was stained with propidium iodide (Miltenyi Biotec; diluted 1:1000) at 37°C for 30 min in PBS supplemented with RNAse A (2 μg/ml; Sigma Aldrich) to deplete RNA. The DNA content was measured by flow cytometry using a MACS Quant Analyzer (Miltenyi Biotec) and analyzed using FlowJo. The FUCCI system was used to analyze the length of cell cycle phases. ES-2 cells, stably transduced with IncuCyte^® Cell Cycle Red/Green Lentivirus Reagent (Sartorius), were transfected with indicated siRNAs. Cells in the G2/M phase were enriched by FACS based on their green fluorescence using a FACS Melody sorter (BD Bioscience) 24 h post-transfection. Cell cycles phases were monitored based on their fluorescence using an IncuCyte S3 (Sartorius) starting immediately after sorting. Cell segmentation and quantification was performed using the Cell-By-Cell module (IncuCyte S3; Sartorius). Single cell tracking was subsequently processed using ImageJ.

PD1+ and PD1- tetramer-positive CMV specific CD4+ T cell cells were sorted using a FACSMelody sorter (BD bioscience). Sorted T cells were co-cultured over night with CFSE (Invitrogen) labelled peptide pulsed LCL in triplicate. CFSE-labelled LCL without peptide were used as control. Live CFSE-labelled LCLs were determined by propidium iodide (PI) staining and quantified using a BD Accuri flow cytometer (BD Biosciences). Specific lysis was calculated according to the count of the control culture by 100 × (1 –(experimental group cell count/control cell count)).

The stoplight CRISPR reporter system was generated in A549 cells, using a fluorescent reporter system construct cloned by PNA Bio (Fig. S1). Parental A549 cells were obtained from the American Type Culture Collection (ATCC). The CRISPR reporter construct was packaged and integrated using a lentiviral delivery system. Lenti-transduced cells underwent antibiotic selection for approximately one week prior to utilization of a BD FacsMelody sorter, which was used to establish clonal lines positive for constitutive expression of red fluorescence. Clones were then screened and validated by transfection of RNP using commercial reagent. The chosen clone was then expanded for use in all studies and maintained in F-12K media (Gibco) supplemented with 10% FBS and 1% penicillin/streptomycin.