Log In Sign up
The largest database of trusted experimental protocols

Native page

Manufactured by Bio-Rad
Visit Supplier
Sourced in United States

Native PAGE is a gel electrophoresis technique used for the separation and analysis of proteins in their native, folded state. It allows for the separation of proteins based on their size, shape, and charge without denaturing them. This technique is commonly used in biochemistry and molecular biology research to study protein structure, function, and interactions.

Automatically generated - may contain errors

Lab products found in correlation

Quantstudio 6 flex real time pcr system, by Thermo Fisher Scientific (2 mentions) Imagequant las 400, by GE Healthcare (1 mentions) Horseradish peroxidase hrp conjugated secondary antibody, by Santa Cruz Biotechnology (1 mentions) Nu page, by Bio-Rad (1 mentions) Image studio lite software, by LI COR (1 mentions) Clarity ecl, by Bio-Rad (1 mentions) Acrylamide bis tris protein gels, by Bio-Rad (1 mentions) Lf pvdf membranes, by Merck Group (1 mentions) Low fat milk, by Cell Signaling Technology (1 mentions) Vivaspin 2, by Sartorius (1 mentions) His trap lambda fab select column, by GE Healthcare (1 mentions) Toxineraser endotoxin removal resin, by GenScript (1 mentions) Toxinsensor chromogenic lal endotoxin assay kit, by GenScript (1 mentions) Typhoon 9410 phosphorimager, by GE Healthcare (1 mentions) Sybr green master mix, by Thermo Fisher Scientific (1 mentions) Amplitaq dna polymerase, by Thermo Fisher Scientific (1 mentions) α 32p dctp, by PerkinElmer (1 mentions) Improm 2 reverse transcriptase, by Promega (1 mentions)

4 protocols using native page

1

Western Blot Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Material obtained from IP or ConA‐agarose concentration as described in the previous section was resolved either by SDS/PAGE or by nondenaturing PAGE on pre‐cast NuPAGE™ 4–12% w/v acrylamide Bis/Tris Protein Gels and NativePAGE™ 3–12% w/v acrylamide Bis/Tris Protein Gels (Bio‐Rad Laboratories Ltd), respectively. Samples were then transferred to LF‐PVDF membranes (Millipore Ltd, Hertfordshire, UK). Membranes were saturated in 5% w/v low‐fat milk (Cell Signaling Technology, Danvers, MA, USA) (New England Biolabs Ltd) in PBS‐0.1% v/v Tween, probed with the indicated primary antibodies and horseradish peroxidase (HRP)‐conjugated secondary antibodies (Santa Cruz Biotechnology, Dallas, USA) and revealed by ECL (Clarity; Bio‐Rad Laboratories Ltd). Western blot images were acquired with the Image Quant Las400 (GE Healthcare Life Sciences, CA, USA) and analysed with image studio lite software (LI‐COR Biosciences, Cambridge, UK). Statistical analysis was performed using the graphpad prism program.
Ronzoni R., Heyer‐Chauhan N., Fra A., Pearce A.C., Rüdiger M., Miranda E., Irving J.A, & Lomas D.A. (2020). The molecular species responsible for α1‐antitrypsin deficiency are suppressed by a small molecule chaperone. The Febs Journal, 288(7), 2222-2237.
+ Open protocol
+ Expand
2

Determining Native Size of Truncated FTα

Check if the same lab product or an alternative is used in the 5 most similar protocols
To determine the native size of truncated FTα of rat and human, size exclusion chromatography (SEC) was used (Superdex 200 HiLoad 16/600 columns (GE Healthcare Life Sciences, Freiburg, Germany)). Therefore, FTα was expressed and purified by IMAC as described above. The resulting elution fractions were dialyzed over night at 4 °C in anion exchange chromatography buffer (50 mM Tris/HCl pH 7.5, 5 mM MgCl2, 3 mM DTT), applied to the UNO Q6 monolith ion exchange column (BioRad, Hercules, CA, USA) and eluted with an increasing NaCl gradient (from 0 to 1000 mM). The resulting peaks were analysed by SDS-PAGE, the FTα containing fractions concentrated by Vivaspin 2, (30 kDa, Sartorius, Stonehouse, UK), dialysed against SEC buffer (50 mM Tris/HCl pH 7.5, 5 mM MgCl2, 3 mM DTT, 300 mM NaCl), applied to a SEC column (HiLoad 600 superdex 200 pg column, GE healthcare) and eluted by isocratic flow. The resulting peaks were analysed by SDS-PAGE for purity. Different amounts of pure protein (2, 3 and 5 µg) were applied to a native PAGE (BioRad) and analysed by Coomassie staining and immuno-blot as described.
Hagemann A., Tasillo S., Aydin A., Kehrenberg M.C, & Bachmann H.S. (2022). Impact of a conserved N-terminal proline-rich region of the α-subunit of CAAX-prenyltransferases on their enzyme properties. Cell Communication and Signaling : CCS, 20, 118.
+ Open protocol
+ Expand
3

Purification of hTLR4-Fab01 Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols
A single clone was reinoculated in LB medium containing 100 mg/ml of ampicillin, induced by 1 mmol/L isopropyl β-D-thiogalactopyranoside (IPTG) at 37°C and harvested 24 hours later. Both bacteria lysate and sonicated supernatant were detected by SDS-PAGE with Coomassie blue staining. The soluble hTLR4-Fab01 was purified from the periplasm by immobilized metal affinity chromatography (IMAC) using His-trap Lambda Fab Select column (GE healthcare, Madison, WI, USA) according to the manufacturer’s instructions. The purity of the hTLR4-Fab01 was analyzed by SDS-PAGE (12%) or native-page (Bio-Rad, CA, USA) with Coomassie Blue staining.
The endotoxin concentration during the Fab preparation was examined with ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (Genscript, Nanjing, China). The hTLR4-Fab01 solution was purified with ToxinEraser™ endotoxin removal resin (Genscript, Nanjing, China) The final endotoxin level of Fab solution was decreased to less than 0.1 EU/ml.
Wang M., Zheng W., Zhu X., Xu J., Cai B., Zhang Y., Zheng F., Zhou L., Yang Z., Zhang X., Wang C., Nie S, & Zhu J. (2016). A Human Anti-Toll Like Receptor 4 Fab Fragment Inhibits Lipopolysaccharide-Induced Pro-Inflammatory Cytokines Production in Macrophages. PLoS ONE, 11(1), e0146856.
+ Open protocol
+ Expand
4

Quantification of H3-3A WT and Mutant Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cells or tissues as described above, and reverse-transcribed with ImProm-II reverse transcriptase (Promega) using oligo-dT primers. Total H3-3A cDNA was amplified with AmpliTaq DNA polymerase (Thermo Fisher) using Fwd 5’- GGACTTTAAAACAGATCTGCGCTT and Rev 5’- GTCTTTTGGCATAATTGTTACACGT primers that sit on exon 3 and exon 4 (downstream of the H3-3A mutation site in exon 2), respectively. The H3-3AWT allele was amplified using Fwd 5’-GCTACAAAAGCCGCTCTCAA; the H3-3AK27M mutant allele was amplified using Fwd 5’- GCTACAAAAGCCGCTCGAAT; and the same Rev 5’- CCAGACGCTGGAAGGGAAGT primer was used for both. cDNA from minigenes was amplified using vector-specific (pcDNA3.1) primers, listed in Supplementary Table 2. For radioactive PCR, 0.16 μL of 250uCi [α-32P]-dCTP (PerkinElmer, NEG-013H) was added to a 20-μL PCR reaction. Amplicons were separated by 5% native PAGE (Bio-Rad), followed by phosphorimage analysis on a Typhoon 9410 phosphorimager (GE Healthcare). Band intensities were quantified using Image J, and the values normalized for the G+C content according to the DNA sequence. For RT-qPCR, 2x SYBR green master mix (Applied Biosystems) was used, and the cDNA was analyzed on a QuantStudio 6 Flex Real-Time PCR system (ThermoFisher Scientific). Fold changes were calculated using the ΔΔCq method.
Zhang Q., Yang L., Liu Y.H., Wilkinson J.E, & Krainer A.R. (2023). Antisense oligonucleotide therapy for H3.3K27M diffuse midline glioma. Science translational medicine, 15(691), eadd8280.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!