Abi prism 3100 genetic analyzer system

For both Burkholderia and non-Burkholderia isolates that were isolated in this study, recA, bdha and 16S rDNA gene sequencing was performed to confirm the organism identity. Respective primers used for PCR amplifying the three genes from each isolate are listed in Table 2. Sequencing reactions were prepared using Applied Biosystems Big Dye Terminator ready reaction mix version 3.1 as per manufacturer’s instructions and capillary electrophoresis was run in Applied Biosystems ABI-Prism 3100 genetic analyzer system using Applied Biosystems Performance Optimized Polymer 6 (POP-6). Resultant raw sequence data obtained from both template and anti-sense strands of the PCR products were aligned to derive consensus sequence using the CAP contig assembly program of the BioEdit software v7.2.5. Consensus sequences were analyzed using Basic Local Alignment Search Tool (BLASTN) (www.ncbi.nlm.nih.gov) to establish the correct organism identity. The sequences were analyzed for chimera as described elsewhere [33 (link)].

The full length of the bacterial 16S rRNA gene was amplified using the primers 27F (5′‐AGAGTTTGATCCTGGCTCAG‐3′) and 1492R (5′‐TACGGYTACCTTGTTACGACTT‐3′) at an annealing temperature of 51°C
³² (link). The PCR mixtures contained 12.5 μl 2× Taq PCR Mix (Sangon), 0.2 μM forward primers, 0.2 μM reverse primers, and 10 ng template, brought up to a final volume of 25 μl with ddH₂O. The amplification products were visualized by electrophoresis on 1.0% agarose gels and purified with the Gel Advance gel extraction system (Viogene). Then, the purified products were cloned into the pUCmT Vector and transformed into E. coli XL1‐Blue for growth. Clones were randomly screened from each single‐cell sample and sequenced using an ABI Prism 3100 genetic analyzer system (Applied Biosystems).
The quality of each sequence was checked by the Phred/Phrap program
³³ (link). High‐quality sequences were compared with the NCBI public nucleotide database using BblastN software (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to obtain the approximate taxonomic identification of the single bacterium. The sequences have been submitted in GenBank, with accession numbers OP090257–OP090315.