Anti parp1

The levels of Bcl-2, Bax, Caspase3, and PARP1, regulatory genes involved in the intracellular Ca²⁺ homeostasis, and apoptosis pathways, were determined by western blot analysis. Cells were harvested and lysed for western blot analysis. Lysates were prepared as previously described (Zhang et al., 2019 (link)). Membranes were incubated with the following primary antibodies: anti Bcl-2 (1:800, ABclonal, United States), anti Bax (1:800, ABclonal, United States), anti Caspase3 (1:1,000, ABclonal, United States), anti PARP1 (1:1,000, ABclonal, United States). HRP-conjugated secondary Abs were applied, and a supersensitive ECL Chemiluminescence Kit (Beyotime, China) was used to detect proteins. anti-β-actin (1:1,600, ABclonal, United States) was used as a loading control.

Viral vectors bearing shRNAs were generated based on the pLKO1 vector. The sequence targeting SIRT1 was 5′‐CATGAAGTGCCTCAGATATTA‐3′. For the luciferase reporters, the promoters of SIRT1 and SIRT6 were amplified from genomic DNA of HCA2‐hTERT cells and cloned into a pGL3‐basic plasmid.
The antibodies used in the study were as follows: anti‐53BP1 (CST, Cat. # 4937S), anti‐DNA‐PKcs (Abcam, Cat. # ab32566), anti‐RAD50 (Abclonal, Cat. # A3078), anti‐NBS1 (CST, Cat. # 3002), anti‐BRCA1 (Abclonal, Cat. # A0212), anti‐CtIP (active motif, Cat. # 61141), anti‐KU70 (Abclonal, Cat. # A0883), anti‐KU80 (Abclonal, Cat. # A5862), anti‐LIG4 (Abclonal, Cat. # A1743), anti‐MRE11 (Abclonal, Cat. # A2559), anti‐PARP1 (Abclonal, Cat. # A3121), anti‐XLF (Abclonal, Cat. # A4985), anti‐XRCC4 (Abclonal, Cat. # A7539), anti‐β‐tubulin (CMCTAG, Cat. # AT0050), anti‐EXO1 (Abclonal, Cat. # A6810), anti‐RPA2 (Abclonal, Cat. # A2189), anti‐RAD51 (Abclonal, Cat. # ab88572), anti‐SIRT1 (Abcam, Cat. # ab110304), anti‐SIRT2 (Abclonal, Cat # A0273), anti‐SIRT6 (Abcam, Cat. # ab62738), anti‐SIRT7 (Proteintech, Cat. # 12994‐1‐AP), anti‐p16 (Abcam, Cat. # ab108349), and anti‐p21 (Abcam, Cat. # ab109199).