siRNA to PKCiota in OVCAR3, IGROV, and SKOV3 was performed using siPORT amine reagent (Ambion, Grand Island, NY) using the reverse transfection protocol according to the manufacturer’s instructions. 2.3 × 105 cells were used per well of 6 well plates. 20nM PKCiota siRNA (gene code 309 and 311) and Silencer Negative Control Number 1 (cat# 4611), both from Ambion were transfected with X-tremeGENE (Genentech, San Francisco, CA), according to the manufacturer’s protocol. To select stable IGROV cells, they were transfected with pRS-shPKCiota (Origene, Rockville, MD #TR320472) using GeneJuice (Millipore) according to the manufacturer’s protocol. shPKCiota 7 sequence TGACCAGAACACAGAGGATTATCTCTTCC targeting exon 14 and and shPKCiota 8 sequence CAGGAGATACAACCAGCACTTTCTGTGGT targeting exon 13 were determined to target only a single sequence. shControl (shRNA 3; CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG) was the control, not specific for PKCiota. Stable clones were selected using 1 μg/mL Puromycin. OVCA420 cells were transfected with pcDNA3.1 constructs containing sequences coding for full-length cyclin E (EL) or the LMW-E forms (T1 and T2) using fuGENE 6 (Roche) according to the manufacturer’s instructions.
Pkciota sirna
Manufactured by Thermo Fisher Scientific
PKCiota siRNA is a small interfering RNA (siRNA) designed to target and silence the expression of the PKCiota gene. It is a molecular biology tool used for gene knockdown studies.
Automatically generated - may contain errors
2 protocols using pkciota sirna
1
siRNA Knockdown of PKCiota in Ovarian Cancer Cell Lines
2
siRNA Knockdown of PKCiota in Ovarian Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNA to PKCiota in OVCAR3, IGROV, and SKOV3 was performed using siPORT amine reagent (Ambion, Grand Island, NY) using the reverse transfection protocol according to the manufacturer’s instructions. 2.3 × 105 cells were used per well of 6 well plates. 20nM PKCiota siRNA (gene code 309 and 311) and Silencer Negative Control Number 1 (cat# 4611), both from Ambion were transfected with X-tremeGENE (Genentech, San Francisco, CA), according to the manufacturer’s protocol. To select stable IGROV cells, they were transfected with pRS-shPKCiota (Origene, Rockville, MD #TR320472) using GeneJuice (Millipore) according to the manufacturer’s protocol. shPKCiota 7 sequence TGACCAGAACACAGAGGATTATCTCTTCC targeting exon 14 and and shPKCiota 8 sequence CAGGAGATACAACCAGCACTTTCTGTGGT targeting exon 13 were determined to target only a single sequence. shControl (shRNA 3; CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG) was the control, not specific for PKCiota. Stable clones were selected using 1 μg/mL Puromycin. OVCA420 cells were transfected with pcDNA3.1 constructs containing sequences coding for full-length cyclin E (EL) or the LMW-E forms (T1 and T2) using fuGENE 6 (Roche) according to the manufacturer’s instructions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!