LLC-PK1 cells (ATCC) were maintained in minimum essential medium (MEM) supplemented with 3% FBS. Mouse renal PTCs were developed as previously described (54 (link)). Cells were maintained at 33°C in DMEM/F-12 containing 2.5% FBS and IFN-γ and then transferred to 37°C for differentiation before use (54 (link)). The HEK293T (ATCC) cells were maintained in DMEM supplemented with 10% FBS. Cells were treated with AA (2.5–5 μg/mL; Sigma-Aldrich, A5512), PAC (10 μM; Sigma-Aldrich, T7402), or respective vehicles in complete medium for 48 hours. Primary PTCs were isolated from WT mice or CG1-KO mice as described previously (55 (link)). In brief, kidney cortex was minced, digested with collagenase (Worthington Biochemical Corporation) and trypsin inhibitor (Worthington Biochemical Corporation), and centrifuged in 32% Percoll medium to purify PTCs. Primary PTCs were then plated in collagen-coated dishes and maintained in DMEM/F-12 medium supplemented with insulin, transferrin, selenium, 0.05 μM hydrocortisone, and 50 μM vitamin C. To avoid changes in PTC phenotype due to repeated passages, these cells were plated as soon as they became confluent for experiments. Primary PTCs were treated with AA at a concentration of 5 to 10 μg/mL for the times indicated.
Llc pk1 cells
Manufactured by American Type Culture Collection
Sourced in United States
LLC-PK1 cells are a well-established cell line derived from the kidney of a male Landrace pig. These cells are commonly used as an in vitro model for studying various aspects of renal physiology and toxicology.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (13 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (5 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (4 mentions)
Dulbecco s modified eagle s medium, by Thermo Fisher Scientific (2 mentions)
Penicillin, by Thermo Fisher Scientific (2 mentions)
Streptomycin, by Thermo Fisher Scientific (2 mentions)
Thapsigargin, by Merck Group (2 mentions)
Powerwave xs, by Agilent Technologies (2 mentions)
α minimum essential medium, by Thermo Fisher Scientific (2 mentions)
A5512, by Merck Group (1 mentions)
T7402, by Merck Group (1 mentions)
Trypsin inhibitor, by Worthington (1 mentions)
Hek293t, by American Type Culture Collection (1 mentions)
Collagenase, by Worthington (1 mentions)
Chloroquine, by Merck Group (1 mentions)
Atg12, by Cell Signaling Technology (1 mentions)
Antibodies to cleaved caspase 3, by Cell Signaling Technology (1 mentions)
Antibodies to β actin, by Santa Cruz Biotechnology (1 mentions)
M199 medium, by Thermo Fisher Scientific (1 mentions)
Tunicamycin, by Merck Group (1 mentions)
29 protocols using llc pk1 cells
1
Cultivating Renal Proximal Tubular Cells
2
Autophagy and ER Stress Response in LLC-PK1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LLC-PK1 cells (porcine kidney proximal tubule epithelial cells) purchased from the ATCC were grown in M199 medium (Gibco) supplemented with 5% (v/v) heat-inactivated fetal bovine serum, 100 U/mL penicillin and 100 μg/mL streptomycin (all from Invitrogen, Carlsbad, CA) at 37°C in a humidified atmosphere containing 5% CO2. ATG5 (-/-) and wild-type MEFs were obtained from the RIKEN BioResource Center (Ibaraki, Japan) and maintained in 10% Dulbecco’s Modified-Eagle Medium (DMEM). Tunicamycin, thapsigargin, 3-methyladenine (3-MA), wortmannin, chloroquine, H202, and TBHP were obtained from Sigma. The caspase 3/7 substrate Asp-Glu-Val-Asp-aminomethyl coumarin (DEVD-AMC) was purchased from Peptide International. ER stress signaling sampler kit (Cat# 9956), mTOR signaling sampler kit (Cat# 9862S), and antibodies to cleaved caspase–3 (Cat # 9661), Atg5 (Cat # 2630), Atg12 (Cat # 4180), and LC3 (Cat # 3868) were purchased from Cell Signaling Technology (Danvers, MA). Antibodies to beclin–1 (Cat # 612112) and p62 (Cat # 610832) were from BD-Bioscience (San Diego, CA) and antibodies to β-actin (Cat # sc1616-R) were from Santa Cruz Biotechnology (Santa Cruz, CA).
3
Porcine Deltacoronavirus Infection Study
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PDCoV strain CHN-HN-2014 (GenBank accession number KT336560), which was isolated from a suckling piglet with acute diarrhea in China in 2014, was used in this study. SeV was acquired from the Centre of Virus Resource and Information at the Wuhan Institute of Virology. LLC-PK1 cells, purchased from ATCC, were cultured at 37 °C in 5% CO2 in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum, and these cells were used to amplify PDCoV. Poly(I:C) was purchased from Sigma-Aldrich as a sodium salt and dissolved in water to obtain a stock solution of 1 mg/mL. Rabbit polyclonal antibodies against NF-κB p65, phosphorylated NF-κB p65 (p-p65), IRF3, and phosphorylated IRF3 (p-IRF3) were purchased from ABclone (China). Mouse monoclonal antibodies (mAbs) against β-actin were purchased from Medical and Biological Laboratories (Japan). The monoclonal antibody used for the detection of PDCoV N protein was produced from hybridoma cells derived from Sp2/0 myeloma cells and the spleen cells of BALB/c mice immunized with the recombinant N protein from PDCoV strain CHN-HN-2014.
4
Porcine and Human Cell Lines for PDCoV
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human embryonic kidney cells (HEK-293T) and porcine kidney cells (PK-15) were obtained from the China Center for Type Culture Collection. LLC-PK1 cells for PDCoV infection were purchased from the ATCC (ATCC number CL-101) and cultured at 37 °C in 5% CO2 in Dulbecco's Modified Eagle's medium (Invitrogen, USA) supplemented with 10% fetal bovine serum. PDCoV strain CHN-HN-2014 (GenBank number KT336560) isolated from a suckling piglet with severe diarrhea in China in 2014, was the object of this research (Dong et al., 2016 (link)). Sendai virus (SEV) was acquired from the Center of Virus Resource and Information at the Wuhan Institute of Virology.
5
Screening for PTHR1 Agonists Using Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To identify small-molecule agonists of PTHR1, we used a cell-based high-throughput screening method employing LLC-PK1 cells (ATCC) expressing hPTHR1 (HKRK-B7 cells) and using urokinase-type plasminogen activator expression as a readout40 (link). The hit compounds found from our compound library were then evaluated for their ability to increase cAMP in HKRK-B7 cells. Parental LLC-PK1 cells, which express porcine calcitonin receptors but not hPTHR1, were used as a negative control. The hit compounds were optimized for potency and other properties such as solubility and metabolic stability to identify a lead compound possessing in vitro and in vivo activities similar to that of hPTH(1–34). This compound was further optimized to improve oral bioavailability to yield a clinical candidate compound, PCO371.
6
Molecular Interactions in Mammalian Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human embryonic kidney cells (293T cells; CRL-11,268) and HeLa cells (CCL-2) were obtained from ATCC. 293T and HeLa cells were used for immunoprecipitation and confocal assay, respectively. African green monkey kidney cells (Vero cells, CCL-81) and porcine kidney cells (LLC-PK1 cells, CL-101) were obtained from ATCC. These cells were cultured using 10% fetal bovine serum (FBS; Gibco, 10,099,141) in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, 12,430,054) and maintained at 37 °C with 5% CO2. Lipofectamine 3000 (Invitrogen, L3000015) was used to transfect cells with the indicated plasmids. Lipofectamine RNAiMAX (Invitrogen, 13,778,150) was used to transfect cells with siRNA. The simian TRIM21 siRNA and the control siRNA were synthesized by GenePharma (Shanghai, China). The siRNA sequences are listed in Table 1 .
Primer and siRNA sequences used in this study
| Purpose | Primer | Sequence (5′-3′) |
|---|---|---|
| Real-time PCR | PEDV N forward | GAGGGTGTTTTCTGGGTTG |
| PEDV N reverse | CGTGAAGTAGGAGGTGTGTTAG | |
| SUS TRIM21 forward | CCAGACTCCCCTCTACCCT | |
| SUS TRIM21 reverse | TTCCACCGTCATTGAAACC | |
| MACACA TRIM21 forward | CCTTCGTGGAGCCTGTGAGC | |
| MACACA TRIM21 reverse | GGCGGAGATTCCTGAGCAGA | |
| β-actin forward | TCCCTGGAGAAGAGCTACGA | |
| β-actin reverse | AGCACTGTGTTGGCGTACAG | |
| siRNA assay | si-mTRIM21 sense | GGAAUGCAUCUCUCAGGUUTT |
| si-mTRIM21antisense | AACCUGAGAGAUGCAUUCCTT | |
| NC sense | UUCUCCGAACGUGUCACGUTT | |
| NC antisense | ACGUGACACGUUCGGAGAATT |
7
Culturing Porcine Kidney Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LLC-PK1 cells (ATCC, Manassas, VA, USA), a porcine PT cell line, were maintained in low glucose DMEM (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) and 1% penicillin/streptomycin (Gibco) at 37 °C and 5% CO2. Cells were used between passages 5 and 20. After 2 days of growth, cells were serum starved overnight and different treatments were performed as described in the figure legends. When indicated, cells were seeded in Transwell inserts (Greiner Bio-One, Kremsmünster, Austria) and grown for 5 days. Cells were seeded on coverslips in 24-well plates for microscopy analysis.
8
Comparative Cell Culture Techniques
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human cervix adenocarcinoma (HeLa) and proximal tubular renal porcine LLC-PK-1 cells were obtained from ATCC (Rockville, MD). wtMEFS, previously established in the referenced publications [54] (link), were kindly provided by Dr. Franceso Cecconi. The HEI-OC1 cell line (House Ear Institute-Organ of Corti-1) was obtained from F. Kalinec and primary human dermal fibroblasts (HDFn) were obtained from Cascade Biologics. HeLa, HDFn, wtMEFS cells were cultured in DMEM supplemented with 10% FBS (Invitrogen). LLC-PK-1 cell line was grown in M199 supplemented with 3% FBS. HEI-OC1 cells were cultured in antibiotic free DMEM with 10% FBS (GIBCO) and 5 µg/ml of gamma interferon (Sigma) at 33°C and 10% CO2 in air. All the rest of cell lines were maintained at 37°C in an atmosphere of 5% carbon dioxide. Cisplatin (CDDP) and ebselen were purchased from Sigma and pan-caspase inhibitor Z-Val-Ala-Asp(OMe)-fluoromethylketone (zVAD-fmk) from Tocris. IDN-5665 was synthesized by Laboratorios Salvat, S.A. LipofectamineTM 2000 (Invitrogen) was used according to the manufacturer’s instructions to transfect HeLa cells with the control siRNA (Rsi; Cell Signaling) and Apaf-1 siRNA (Dharmacon and Cell Signaling).
9
Propagation of PDCoV and PEDV in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PDCoV isolates NT1_1215 (accession number KX361345) and PEDV isolate P1915-NPF-071511A (accession number KX981900) were used in the study. These two viruses were isolated from two pig herds experiencing PDCoV and PEDV outbreaks.
LLC-PK1 cells (ATCC CL-101) and Vero C1008 cells (ATCC CRL-1586) were used to propagate PDCoV and PEDV, respectively. Vero C1008 and LLC-PK1 cells were maintained using growth medium (Dulbecco’s Modified Eagle Medium (DMEM; Gibco, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco, USA) for virus propagation. At 80% confluency, growth medium was discarded, and the cells were washed twice with 1X PBS (1X phosphate-buffered saline; 0.1 M, pH 7.2) followed by maintenance medium (DMEM (Gibco, USA) supplemented with 8 µg/ml trypsin/EDTA (Gibco, USA)). Each virus was added into each cell line and incubated at 37 °C with 5% CO2 for 60 min. After incubation, the inoculated cells were washed twice with 1X PBS. A maintenance medium was added to the inoculated cells, and the cells were incubated at 37 °C with 5% CO2 until a cytopathic effect (CPE) was observed.
LLC-PK1 cells (ATCC CL-101) and Vero C1008 cells (ATCC CRL-1586) were used to propagate PDCoV and PEDV, respectively. Vero C1008 and LLC-PK1 cells were maintained using growth medium (Dulbecco’s Modified Eagle Medium (DMEM; Gibco, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco, USA) for virus propagation. At 80% confluency, growth medium was discarded, and the cells were washed twice with 1X PBS (1X phosphate-buffered saline; 0.1 M, pH 7.2) followed by maintenance medium (DMEM (Gibco, USA) supplemented with 8 µg/ml trypsin/EDTA (Gibco, USA)). Each virus was added into each cell line and incubated at 37 °C with 5% CO2 for 60 min. After incubation, the inoculated cells were washed twice with 1X PBS. A maintenance medium was added to the inoculated cells, and the cells were incubated at 37 °C with 5% CO2 until a cytopathic effect (CPE) was observed.
10
Culturing LLC-PK1 Kidney Epithelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LLC-PK1 cells were used as a model of porcine kidney epithelial cells. LLC-PK1 cells (ATCC, Manassas, VA) was cultured at 37 °C in 5% CO2 in Medium 199 containing 10% FBS.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!