RNA extraction, RT and quantitative PCR were performed as described previously [53 (link)]. Primer pairs (5´-3´) were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) as follows: Pim-1 (NM_017034.1) forward, ctgctcaaggacacagtctaca; Pim-1 reverse, agggacaggcaccatctaataa; PCNA (NM_022381.1) forward, gggtgaagttttctgcgagt; PCNA reverse, cagtggagtggcttttgtga; β-actin (NM_031144) forward, cccatctatgagggttacgc, β-actin reverse, tttaatgtcacgcacgatttc. PCR was conducted using a LightCycler480 II instrument (Roche Ltd., Guangzhou, China). Relative abundances of target mRNAs were determined from the CT values and plotted as the fold-change compared with the control groups.
Pim 1
Manufactured by Sangon
Sourced in China
Pim-1 is a laboratory instrument used for protein expression and purification. It functions as a centrifugal protein purification system.
Automatically generated - may contain errors
Lab products found in correlation
1 protocol using pim 1
1
Quantitative PCR Analysis of Gene Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!