By using a NanoDrop, the concentration of the purified RNA was measured and diluted to 100 ng/μl and 50 ng/μl with RNase-free water. We denatured purified RNA by heating it to 95 °C for 3 min and cooling it on ice. Nucleic acid transfer was optimized using the Hybond-N + membrane (Solarbio). Incubation with mouse anti-m5C antibody (1:1000; MAb-081-010, Diagenode) or rabbit anti-m6A antibody (1:1000, 202003, Synaptic Systems) was performed overnight at 4 °C after UV crosslinking. All membranes were incubated with HRP-labelled mouse IgG secondary antibodies (ZB-2305, Zsbio Store-bio) or rabbit IgG secondary antibodies (ZB-2316, Zsbio Store-bio) for 1 h before visualization by an imaging system (Bio-Rad, USA). An ECL Western blotting Detection Kit (Sevenbio, Beijing, China) was used to visualize the membrane. The other membrane was loaded with methylene blue.
Mab 081 010
Manufactured by Diagenode
The MAb-081-010 is a laboratory equipment product manufactured by Diagenode. It is designed for use in research and scientific applications. The core function of the MAb-081-010 is to perform specific tasks, but no further details on its intended use can be provided in an unbiased and factual manner.
Automatically generated - may contain errors
Lab products found in correlation
Ecl western blotting detection kit, by Thermo Fisher Scientific (2 mentions)
Hybond n membrane, by Cytiva (2 mentions)
Hybond n membrane, by Solarbio (1 mentions)
Rabbit anti m6a antibody, by Synaptic Systems (1 mentions)
Horseradish peroxidase conjugated anti mouse igg secondary antibody, by Santa Cruz Biotechnology (1 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (1 mentions)
Oligotex mrna mini kit, by Qiagen (1 mentions)
Qubit rna assay kit, by Thermo Fisher Scientific (1 mentions)
Rna nano 6000 assay kit, by Agilent Technologies (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Mirneasy mini kit, by Qiagen (1 mentions)
Bioanalyzer 2100 system, by Agilent Technologies (1 mentions)
4 protocols using mab 081 010
1
RNA Quantification and Detection of m5C and m6A
2
MeDIP Protocol with Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MeDIP was performed according to the protocol of Mohn et al. [40 (link)] with antibodies: IgG (46540; Santa Cruz Biotechnologie), 5mC (MAb-081-010; Diagenode) and 5hmC (MAb-31HMC-020; Diagenode). The following primers were used for semi quantitative PCR amplification: DUSP2CIPU2: GGGTGGGCGCAAAAACGGAGGG, DUSP2CIPL2: CCGGGGCACCATACAAGGGCAGA, bACTRTFW: CCTTCCTTCCTGGGCATGGAGTC, bACTRTFW: CGGAGTACTTGCGCTCAGGAGGA.
3
Dot Blot Analysis of m5C RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dot blot analysis was performed as previously described[5 ] with slight modifications. The purified RNA was heated at 95 °C for 3 min, followed by chilling on ice immediately. RNA was spotted on a Hybond‐N+ membrane (Amersham), followed UV crosslinking. The membrane was washed by 1x PBST buffer (PBS with Tween‐20), blocked with 5% of non‐fat milk in PBST, and incubated with anti‐m5C antibody (1:1000; MAb‐081‐010, Diagenode) overnight at 4 °C. After the membrane was washed by 1x PBST, incubating with horseradiash‐peroxidase‐conjugated anti‐mouse IgG secondary antibody (Santa Cruz). The ECL Western Blotting Detection Kit (Thermo) was used to visualize the membrane.
4
Quantifying RNA Methylation Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the RNeasy Plus Mini kit (QIAGEN). mRNA was enriched from total RNA using the Oligotex mRNA Mini Kit (QIAGEN), and small RNA was separated from rRNA in the remaining fraction using the miRNeasy Mini Kit (QIAGEN). RNA concentration and quality were measured by the Qubit RNA Assay Kit using a Qubit 2.0 Fluorometer (Life Technologies) and the RNA Nano 6000 Assay Kit using a Bioanalyzer 2100 system (Agilent). Dot Blot Analysis of m 5 C Levels Dot blot analysis was performed as described previously (Shen et al., 2016 (Shen et al., , 2017)) . Purified RNA was first denatured by heating at 95 C for 3 min, followed by chilling on ice immediately. RNA was spotted on a Hybond-N+ membrane (Amersham) optimized for nucleic acid transfer. After UV crosslinking, the membrane was washed by 13 PBST buffer (PBS with Tween-20), blocked with 5% of non-fat milk in PBST, and incubated with anti-m 5 C antibody (1:1000; MAb-081-010, Diagenode) overnight at 4 C. After incubating with horseradish-peroxidaseconjugated anti-mouse IgG secondary antibody (Santa Cruz), the membrane was visualized by the ECL Western Blotting Detection Kit (Thermo).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!