Hucct1

Manufactured by Shanghai Cell Bank

Sourced in China

HuCCT1 is a human cell line derived from extrahepatic bile duct carcinoma. It is a well-established in vitro model for the study of bile duct cancer.

Automatically generated - may contain errors

Lab products found in correlation

Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (4 mentions) Hebepics, by ScienCell (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions) Hibec, by American Type Culture Collection (1 mentions) Control lentiviral activation particles sc 437282, by Santa Cruz Biotechnology (1 mentions) Hccc 9810, by Shanghai Cell Bank (1 mentions) Qbc939, by Shanghai Cell Bank (1 mentions)

4 protocols using hucct1

Regulation of DLGAP1-AS2 in CCA Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

CCA cell lines HUCCT1 and RBE were obtained from the Shanghai Cell Bank (Shanghai, China). Normal bile duct cell HEBEpics was purchased from the ScienCell Research Laboratories (Carlsbad, CA, USA). Dulbecco's modified Eagle's medium supplemented with 10% FBS and 100 U·mL⁻¹ penicillin–streptomycin was used to culture the cells at 37 °C with 5% CO.
DLGAP1‐AS2 negative control (si‐NC, 5′‐TTCTCCGAACGTGTCACGT‐3′), si‐DLGAP1‐AS2#1 (5′‐CUGGCUGCGAAGUAAUAAAUU‐3′), si‐DLGAP1‐AS2#2 (5′‐GGCAGGAAAUUGUGUUUGU UU‐3′), pcDNA3.1‐DLGAP1‐AS2, miR‐505 inhibitor, miR‐505 mimic, negative control (miR‐NC) and si‐GALNT10 (5′‐ATGAGTACGCAGAGTACAT‐3′) were synthesized by Dharmacon. HUCCT1 and RBE cells were transiently transfected with these sequences by Lipofectamine 2000 as directed by the supplier. After 48 h, the transfection efficiency was measured using qRT‐PCR. The transfected cells were used for subsequent experiments.

Liu Z., Pan L., Yan X, & Duan X. (2020). The long noncoding RNA DLGAP1‐AS2 facilitates cholangiocarcinoma progression via miR‐505 and GALNT10. FEBS Open Bio, 11(2), 413-422.

+ Open protocol

+ Expand

Investigating PIMREG in CCA Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human CCA cell lines HuCCT1 and RBE were purchased from Shanghai Cell Bank,
Chinese academy of medical sciences. The human CAA cell line HUH28 and human
extrahepatic biliary epithelial cells (HEBEpics) were obtained from American
ScienCell Research Laboratories. All the cells were incubated in Dulbecco’s
Modified Eagle Medium (DMEM; Gibco, Grand Island, NY, USA) containing 10% fetal
bovine serum (FBS) and antibiotics, and cultured in a 37°C incubator filled with
5% CO₂. Small interference (si) RNAs against PIMREG (si-PIMREG#1:
5’-AGTGCTAGCATCAGATATTTGCTC-3’; si-PIMREG#2: 5’-TGACCTTGAGCCTTCTATTTGCTC-3’) and
an unspecific scrambled siRNA (si-con: 5’-GATCTTGTAGAACTTGTACCTAGT-3’) were
transfected into indicated cells to implement loss-of-function of PIMREG assays.
The plasmid pcDNA3.1-PIMREG vector and pcDNA3.1 empty vector were transfected
into indicated cells to perform gain-of-function of PIMREG assays. All the
si-RNAs and plasmids were acquired form GeneChem Corporation (Shanghai, China).
The Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) was used to perform the
transfection process following the manufacturer’s instructions. Cells were
collected for subsequent experiments 48 hours after transfection. All cells used
in this report were taken in logarithmic phase.

Jiang Z.M., Li H.B, & Chen S.G. (2020). PIMREG, a Marker of Proliferation, Facilitates Aggressive Development of Cholangiocarcinoma Cells Partly Through Regulating Cell Cycle-Related Markers. Technology in Cancer Research & Treatment, 19, 1533033820979681.

+ Open protocol

+ Expand

Culturing Human Cholangiocarcinoma Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human cholangiocarcinoma cell lines HuCCT1 and CCLP1 were obtained from Shanghai Cell Bank and Chinese Academy of Science. All cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco, USA) and 1% amphotericin B/penicillin/streptomycin (Beyotime, China) in a humidified incubator with 5% CO2 at 37 °C.

Fu Y., Shen K., Wang H., Wang S., Wang X., Zhu L., Zheng Y., Zou T., Ci H., Dong Q, & Qin L.X. (2024). Alpha5 nicotine acetylcholine receptor subunit promotes intrahepatic cholangiocarcinoma metastasis. Signal Transduction and Targeted Therapy, 9, 63.

+ Open protocol

+ Expand

Investigating miR-7-5p and MyD88 in ICC

Check if the same lab product or an alternative is used in the 5 most similar protocols

Our study used several ICC cell lines, of which HCCC-9810, HuCCT1, QBC-939, and RBE were purchased from the Shanghai Cell Bank, Chinese Academy of Sciences (Shanghai, China). The human primary intrahepatic biliary epithelial cell line HIBEC was purchased from ATCC (Manassas, VA, USA). All cells were cultured in DMEM (Thermo Fisher, Waltham, MA, USA) according to the manufacturer’s recommendations. Hsa-miR-7-5p mimics (miR115129142345-1-5), hsa-miR-7-5p inhibitor (miR2170523092350-1-5) and negative control vector were obtained from RiboBio (Guangzhou, China). MyD88 lentiviral activation particles (sc-417166-ACT) and control lentiviral activation particles (sc-437282) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). RBE cells were transfected with miR-7-5p mimics or negative control vector, co-transfected with miR-7-5p mimics and MyD88 lentiviral activation particles or control lentiviral activation particles. HIBEC cells were transfected with negative control vector or hsa-miR-7-5p inhibitor. Cells were transfected 24 h before experiments.

Tang Y., Tang Z., Yang J., Liu T, & Tang Y. (2021). MicroRNA-7-5p Inhibits Migration, Invasion and Metastasis of Intrahepatic Cholangiocarcinoma by Inhibiting MyD88. Journal of Clinical and Translational Hepatology, 9(6), 809-817.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!