Lumacaftor (VX-809) and Ivacaftor (VX-770) were purchased from Selleckchem via ThermoFisher (Pittsburgh, PA); collagen and bovine serum type1 were obtained from Corning (Bedford, MA), Fibronectin and MQAE dye were purchased from Life Technology (Eugene, OR); SYBR® green PCR master mix was obtained from Applied Biosystems (Warrington, UK); PCR custom primers hQCF3 GACAGTTGTTGGCGG TTGCT (sense) and hQCF4 ACCCTCTGAAGGCTCCAGTTC (Antisense) were synthesized by Invitrogen (Carlsbad, CA); procirol AT05 (glycerol distearate) GATTEFOSSE, sequalene, and span 85 were purchased from Sigma (Sant-Louis, MO); tween 80 and polyethylene glycol (PEG 2000) were purchased from Avanti Polar Lipid Inc., (Alabaster USA).
Sequalene
Manufactured by Merck Group
Sourced in Macao
Sequalene is a naturally occurring organic compound used as a raw material in the production of various pharmaceutical and cosmetic products. It serves as a key ingredient in the formulation of adjuvants, which are substances used to enhance the effectiveness of vaccines and other medical treatments. Sequalene is extracted from plant sources and has a role in the stabilization and delivery of active pharmaceutical ingredients.
Automatically generated - may contain errors
Lab products found in correlation
Lumacaftor, by Selleck Chemicals (2 mentions)
Bovine serum type1, by Corning (2 mentions)
Fibronectin, by Thermo Fisher Scientific (2 mentions)
Ivacaftor, by Selleck Chemicals (2 mentions)
Mqae dye, by Thermo Fisher Scientific (2 mentions)
Span 85, by Merck Group (2 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
2 protocols using sequalene
1
Cystic Fibrosis Therapeutic Compound Evaluation
2
Cystic Fibrosis Therapeutic Compound Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lumacaftor (VX-809) and Ivacaftor (VX-770) were purchased from Selleckchem via ThermoFisher (Pittsburgh, PA); collagen and bovine serum type1 were obtained from Corning (Bedford, MA), Fibronectin and MQAE dye were purchased from Life Technology (Eugene, OR); SYBR® green PCR master mix was obtained from Applied Biosystems (Warrington, UK); PCR custom primers hQCF3 GACAGTTGTTGGCGG TTGCT (sense) and hQCF4 ACCCTCTGAAGGCTCCAGTTC (Antisense) were synthesized by Invitrogen (Carlsbad, CA); procirol AT05 (glycerol distearate) GATTEFOSSE, sequalene, and span 85 were purchased from Sigma (Sant-Louis, MO); tween 80 and polyethylene glycol (PEG 2000) were purchased from Avanti Polar Lipid Inc., (Alabaster USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!