Take3 plate

Total RNA was isolated from BEFS‐teton‐MyoD cells after 0, 1, 2, 4, and 6 d of differentiation using TRIzol reagent (iNtRON, Seongnam, Gyeonggi, Korea) according to the manufacturer's instructions. RNA quality was determined at an absorbance of 260 nm (A260) using a BioTek plate reader and Take3 plate (BioTek, Winooski, VT, USA). RNA quality was evaluated based on the A260/280 ratio. cDNA was synthesized from the total RNA using HKGscript 5X RT Premix (HK Genomics, Daejeon, Korea), the conditions were 50 °C for 15 min and 70 °C for 15 min. Real‐time quantitative PCR (qPCR) was run in a LightCycler 96 system (Roche, Basel, Switzerland), using SYBR Green I qPCR Master Mix (Genetbio, Daejeon, Korea). Primer sequences for the target genes were as follows: Glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) forward: 5′‐CAGTATGATTCCACCCACGGC‐3′, reverse: 5′‐ATCTCGCTCCTGGAAGATGGTG‐3′; MyoD forward: 5′‐CAACTGTTCCGACGGCATGATG‐3′, reverse: 5′‐CGCTGTAGTAAGTGCGGTCGTA‐3′; MyoG forward: 5′‐GGCGTGTAAGGTGTGTAAGAGG‐3′, reverse: 5′‐CCTGGAAGCCTTCATTCACCTT‐3′; Myosin heavy chain 1 (MYH1) forward: 5′‐GGCCAGACTGTAGAGCAGGTAT‐3′, reverse: 5′‐GGCAACCATCCACAGGAACATC‐3′. Thermal cycling conditions were: 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s, and 60 °C for 40 s.

DNA isolation was performed using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The efficiency and purity of the obtained eluate were checked using the Epoch (Biotek) spectrophotometer. The measurement was performed on a Take 3 plate (Biotek Instruments, Winooski, Vermont, US) using Microplate Reader Software Gen 5.2.0 (Biotek Instruments, Winooski, Vermont, US).

To measure the mRNA levels of MtlS sRNA, total RNA was isolated from a bacterial culture grown to mid-log phase using a DirectZol RNA miniprep kit (Zymo). For half-life experiments, rifampin (200 to 300 μg/ml) was added upon cells reaching mid-log growth, and samples were extracted at the indicated time points. Following centrifugation (5,000 × g, 5 min, 4°C), the pellets were resuspended in TRI Reagent. Manufacturer instructions were then followed to isolate RNA, with column elution being performed in DNase- and RNase-free ultrapure water. For the qRT-PCR experiments, the remaining DNA was removed from all samples using a Turbo DNA-free kit (Thermo Fisher Scientific), according to the manufacturer’s suggested protocol. RNA concentrations were measured using a Take3 plate (BioTek).