Miseq sequencing

NGS was performed using MiSeq Illumina sequencing technology, focusing on the V3–V4 hyper-variable regions of the 16S rRNA gene to explore the microbial population dynamics in the anodic biofilm. The amplicon library was prepared using Nextera XT Index Kit (Illumina inc.) according to the 16S Metagenomic Sequencing Library Preparation protocol (Part # 15044223 Rev. B)^{8 (link)}. Primers for amplifying the specific region were designed and synthesized at Eurofins Genomics Lab, India. The QC passed amplicons with the Illumina adaptor were amplified using i5 and i7 primers that add multiplexing index sequences and standard adapters required for cluster generation (P5 and P7) as per the standard Illumina protocol. The Illumina overhang adapter sequences were as follows: Forward overhang: 5′ (CGTCGGCAGCGTCAGATGTGTATAAGAGACAG) and Reverse overhang: 5′ (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG). The amplicon libraries were purified by AMPure XP beads and quantified using Qubit Fluorometer. The amplified libraries were analyzed on the 4200 Tape Station system (Agilent Technologies) using D1000 Screen tape per manufacturer instructions. Equimolar quantities of all samples were pooled into one tube^{32 (link)}. The amplicon library pool sequencing was performed on the Illumina MiSeq platform (Eurofins Genomics India Pvt. Ltd.).

Environmental DNA was extracted from brine and salt samples. The brine samples were filtered through 0.45 μm mixed cellulose ester (MCE) membranes. The membrane is used for DNA extractions. DNA extraction protocol from salt and filtered brine were carried out by bead beating using the PowerLyzer^® PowerSoil^® DNA Isolation kit (DNeasy PowerLyzer PowerSoil, QIAGEN Inc., Germantown, MD) with some minor modifications. The alternate lysis protocol that is suggested for hard to lyse cells was used. DNA was quantified using NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific Inc.). Quality was additionally checked by electrophoresis on an Agarose gel (1%), and DNA was stored at -80^oC. Throughout the DNA extraction, preparation, and sequencing processes, a positive control, and negative control, without DNA were used to monitor for contamination. Approximately, 5–10 ng of NanoDrop quantified DNA was amplified using standard Universal primers provided by Illumina targeting the V3–V4 region of the 16S rRNA gene. The PCR products were then subsequently used for Miseq Illumina sequencing according to the manufacturer’s instructions.

Illumina adaptors were added to purified RT-PCR products by PCR (15 cycles) using 0.5 µM forward (Illx_Fo, x denotes different barcodes 1–15, see oligo sequences in Supplementary file 1) and reverse primers (Ill_Ba) and Q5 Hot-Start High-Fidelity 2X Master Mix (Neb). PCR products were gel purified in 3% agarose gel and qPCRed (using NEBNext Library Quant Kit for Illumina) to quantify concentration. Finally, the DNA (consisting of Illumina adapters, barcodes, and RT-PCRed sequence from the RNA extension) were prepared following manufactures protocol for MiSeq Illumina sequencing (Illumina, San Diego, CA) (see, e.g., MiSeq System Guide).

Optimal PCR conditions were determined from DNA extracts of Agaricus bisporus and CIL Plus Mycoactive^™ Potting Soil (for LSU200-F/LSU481-R), and of a Harposporium sp. isolate for LSU200A-F /LSU476A-R. LSU PCR reactions were carried out in a total volume of 25 μL, with 0.5–4 μL template DNA, 12.5 μL of Toughmix (Quanta Biosciences), and 1.25 μL each of forward and reverse primers (5 μM). Optimal PCR conditions were 2 min at 94°C, followed by 29 cycles for 30 s at 94°C, 30 s at 62°C (55°C in first cycle followed by the remainder at 62°C for Ascomycota primers), with a final elongation temperature of 72°C for 18 s. ITS2 PCR reactions followed the protocol outlined by Toju et al. [41 (link)], scaled to a total volume of 25 μL, using 1 μL template DNA (20 ng/μL for peat and soil samples). Optimal PCR conditions were 3 min at 94°C, followed by 35 cycles for 20 s at 94°C, 30 s at 47°C, 20 s at 72°C, with a final elongation temperature of 72°C for 7 min [41 (link)]. PCR products were normalized with a Qubit fluorimeter with the dsDNA HS kit (Life Technologies) and submitted for paired-end MiSeq Illumina sequencing (2 x 300 bp with V3 chemistry) at the London Regional Genomics Centre (Robarts Research Institute, London, Canada).

Cecal content DNA was extracted using the Quick-DNA Fecal/Soil Microbe 96 Kit (ZymoResearch) and the 16S ribosomal RNA (rRNA) gene V3–V4 region was amplified by PCR and sequenced by MiSeq Illumina Sequencing as previously described (28 (link)). Sequencing reads were deposited in the National Center for Biotechnology Information Sequence Read Archive (SRA accession: PRJNA699723). The 16S rRNA gene amplicon sequences were analyzed using the Find, Rapidly, Operational taxonomic units with Galaxy Solution (FROGS) pipeline according to standard operating procedures (29 (link)). Amplicons were filtered according to their size (300–500 nucleotides) and clustered into operational taxonomic units (OTUs) using Swarm (aggregation distance: d = 1 + d = 3). After chimera removal, OTUs were kept when they were present in at least 3 samples and represented more than 0.005% of the total number of sequences (30 (link)). OTU affiliations were performed using the reference database silva138 16S with a minimum pintail quality of 100 (31 (link)). The mean number of reads per sample after filtering was 20,131 (minimum: 11,045; maximum: 37,579).

Whole genomic DNA was extracted from 72 swab frog samples using the DNeasy Blood and Tissue kit (Qiagen, Valencia, CA, United States) following the manufacturer’s instructions including a pretreatment with lysozyme included in the protocol titled: Pretreatment for Gram-Positive Bacteria (page 45). This pretreatment is recommended when trying to extract DNA from Gram-positive bacteria in addition to Gram-negative bacteria. DNA extracted from swabs was used to amplify the V4 region of the 16S rRNA gene using barcoded primers (F515/R806) and PCR conditions adapted from Caporaso et al. (2011) (link). Amplicons were quantified using Quantifluor^TM (Promega, Madison, WI, United States). Composite samples for sequencing were created by combining equimolar ratios of amplicons from the individual samples, followed by cleaning with the QIAquick PCR clean up kit (Qiagen, Valencia, CA, United States). Barcoded composite PCR products were sent to the Dana Farber Cancer Institute’s Molecular Biology Core Facilities (Boston, MA, United States) for MiSeq Illumina sequencing using a 250 bp single read strategy.

The relative abundance of each competing phage at each time point was estimated using MiSeq Illumina sequencing (Illumina Inc., San Diego, CA, USA). The MiSeq reads were mapped to each of the bases differing between the competing phages. The percentage of each unique base was averaged at each time point to give an estimate of the relative proportion of each phage. For any given time point, there was less than a 5% difference between the estimates of the phage proportions.
The predicted percentage, P, of the dominant phage for each chemostat (gray dotted lines in Figures 7 and 8) was based on the growth data of each phage grown without the presence of the reduction sequence and was calculated as follows: P_t+1 = P_t × 2^x, where x is the control fitness, and t is time in hours. These predictions were based on the uninhibited growth rate only, and did not take competitive ability into account. The proportion of each competing phage in the population was then determined by calculating the percentage of each phage of the total.