Sherlock ax kit

All samples/isolates were also examined by PCR techniques for specific detection of Acanthamoeba DNA and to determine genotypes of the particular strains. Extraction of DNA from the samples was performed using commercial Sherlock AX Kit (A&A Biotechnology, Gdynia, Poland). Extraction of DNA from cultured in vitro isolates was performed using commercial Genomic Mini Kit (A&A Biotechnology) for routine genomic DNA extraction, according to the manufacturer's instructions. Then, DNA was stored at −20°C. An Acanthamoeba-specific PCR following the protocol established by Schroeder et al. [21 (link)] amplifying a fragment of the 18S rRNA gene with the primers JDP1 (5′GGCCCAGATCGTTTACCGTGAA3′) and JDP2 (5′TCTCACAAGCTGCTAGGGAGTCA3′) was applied. PCR products were analyzed using GelDoc-IT Imaging Systems (UVP, USA) after gel electrophoresis on agarose gel (Sigma, St. Louis, Missouri) stained with Midori Green DNA stain (Nippon Genetics Europe GmbH, Germany). Cycle sequencing was performed and sequences obtained were compared with data available in GenBank using GeneStudio Pro Software (GeneStudio, Inc., Suwanee, Georgia).

Various soft tissues (muscles, heart, liver, and kidney) as well as blood samples from 256 European bison (211 males and 45 females), collected by the Mammal Research Institute, Polish Academy of Sciences in Bialowieza between 1990 and 2016, were used as DNA sources.
DNA extraction was performed using the following commercial total DNA isolation kits: Syngen DNA Mini Kit (spin-column protocol, Wrocław, Poland), Qiagen DNeasy^®, Blood & Tissue Kit (spin-column protocol), and Sherlock AX Kit (Gdansk, Poland), A&A Biotechnology, a procedure with DNA precipitation, Gdansk, Poland), as per the manufacturer’s guidelines. Many of the materials available were blood samples, and the DNA was obtained using the phenol–chloroform extraction method with ammonium acetate [34 ].

Before DNA extraction, the material prepared from plants and mushroom samples was three times frozen at –70 °C and thawed at 30 °C in a water bath to destroy the egg walls and improve the efficiency of DNA extraction. DNA extraction was performed using a Sherlock AX Kit (A&A Biotechnology, Gdynia, Poland) according to the manufacturer’s instructions. All of the PCR templates were treated with an Anty-Inhibitor Kit (A&A Biotechnology, Gdynia, Poland) which removes polyphenolic PCR inhibitors using specific absorption particles, thereby removing factors that could interfere with the PCR. The PCR templates were stored at −20 °C.

Clean annulus fibrosus fragments (Fig. 6) were cut into 3 × 2 mm pieces with a sterile scalpel blade (Fig. 1b). DNA isolation was performed using a Sherlock AX kit (A&A Biotechnology, Poland) according to the manufacturer’s instruction. The final volume of the DNA solution used was 50 µL.Fig. 6

Fragments of a fibrous ring collected from a charred corpse (case 3): a fragments with visible soot traces, b the other side of one of the fragments presented in photo a

DNA was isolated from blood using DNA Blood Mini kit (A&A Biotechnology, Gdansk. Poland) and from hair follicles using Sherlock AX kit (A&A Biotechnology, Gdansk, Poland). The SRY gene fragment covering the whole coding sequence (851 bp) was amplified by PCR using the primers shown in Supplementary Table S1, and its presence was verified using agarose gel electrophoresis. The X-linked and Y-linked (ZFX and ZFY, respectively) genes were amplified (448 bp) by PCR (Supplementary Table S1) and distinguished by restriction enzyme (BsmI) digestion at 37 °C for 4 h following agarose gel electrophoresis (448 bp for ZFY; 391 and 57 bp for ZFX). Moreover, PCR detection of the Y-chromosome-derived genes was also performed on DNA samples isolated from the ovaries, uterus, and oviduct (Genomic Mini kit, A&A Biotechnology, Gdansk). All PCR primers were designed using Primer3 (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi; accessed on 10 August 2009), and all details (primer sequences, annealing temperatures and the amplicon lengths) are shown in Supplementary Table S1.