Hot firepol evagreen qpcr mix

All reagents, if not separately mentioned, were purchased from Sigma-Aldrich (Germany). The 5×HOT FIREPol EvaGreen qPCR Mix was from Solis BioDyne (Lithuania). The M-MLV reverse transcriptase, Trizol reagent and Fluo-4 Direct Calcium Assay Kit were from Life Technologies (USA). We obtained the CytoTox-ONE assay from Promega (USA). The ATPLite 1 step Luminescence Assay System was purchased in Perkin-Elmer (USA). Primers were synthesized in the Institute of Biochemistry and Biophysics (Poland).

We carried out blood-meal analysis on each individually extracted blood-fed mosquito to determine its vertebrate host. We used primers for cytochrome b (cyt b) and 16S rRNA markers to resolve the vertebrate host source of the blood-meals [25 (link)]. Total nucleic acid (1 μl) from each blood-fed mosquito was used as template in 10-μl PCRs containing 2 μl of 5X HOT FIREPol^® EvaGreen^® qPCR Mix (Solis BioDyne, Estonia) and 10 pmoles of each forward/reverse primer. Thermo-cycling and high-resolution melting (HRM) analysis were carried out in a Rotor-Gene Q real-time PCR thermo-cycler (Qiagen, Hilden Germany) as previously described [26 (link)]. DNA extracted from human, cattle, sheep, goat, pig, camel, and chicken samples served as positive controls in each of the runs. Rotor-Gene Q software 2.1.0 was used to select representative amplicons for post-PCR clean (Exo 1-rSAP combination, Biolabs, UK) and sequencing at Macrogen (The Netherlands).

All cells harvested for gene expression analysis were cultured in six‐well plates. Total RNA was extracted using the TRIzol® reagent (Thermo Fisher, Cat# 15596026) according to manufacturer's instructions. Reverse transcription of total RNA into complementary DNA (cDNA) was performed using SuperScript® III First‐Strand Synthesis System (Thermo Fisher, Cat# 18080051) on S1000 Thermal Cycler (Bio‐Rad) according to manufacturer's instructions. cDNA for 1–5 μg of total RNA were synthesized per reaction. The reverse transcription product was diluted with DEPC‐treated water to achieve final concentration of 5 ng/μl total RNA converted to cDNA for real‐time semi‐quantitative polymerase chain reaction (qPCR). qPCR was performed with 5X HOT FIREPol® EvaGreen® qPCR Mix (Solis Biodyne, Cat# 08‐24‐00001) on either MJ Research PTC‐200 Thermal Cycler (Bio‐Rad) or Applied Biosystems QuantStudio 7 Flex Real‐Time PCR System (Thermo Fisher) according to manufacturer's instructions. HOT FIREPol® DNA Polymerase was activated first at 95°C for 15 min, followed by 45 cycles of (1) denaturation of cDNA at 95°C for 30 s, (2) annealing of primers at 60°C for 30 s, and (3) elongation at 72°C for 30 s. Relative expression of each gene was calculated by normalizing its C_T values to that of glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH). List of primers is provided in Table 1.

Following Chomczynski`s protocol (27 (link)), total RNA of glioma tissues was extracted by TRIzol Reagent (Life Technologies), whereas Total RNA Mini Concentrator Kit (A&A Biotechnology) was used for the extraction of RNA from plasma samples. The concentration and purity of RNA samples were assessed by measuring the 260/280 ratio of absorbance values with the Synergy H4 spectrophotometer (BioTek). cDNA was synthesized from 500 ng of RNA using random hexamers and TaqMan Reverse Transcription Reagents (ThermoFisher Scientific) according to the manufacturer`s instructions. Transcript levels of TET family genes were determined by the quantitative real-time PCR using 5x HOT FirePolEvaGreen qPCR Mix (Solis Biodyne) and primer sets for TET1, TET2, TET3, and the housekeeping gene GAPDH. The primer sequences are listed in Supplementary Table S1. All samples were run in triplicate, and data were normalized to the expression of GAPDH (28 (link)), according to the ΔCt method. While the ΔΔCt method was applied for relative quantification in blood samples.

RNA was isolated using the High Pure RNA Isolation Kit (Roche #11828665001), and reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific #4368813) in the presence of an RNase inhibitor (Invitrogen #10777-019) according to the manufacturer’s instructions. cDNA was analyzed by qPCR using a 5xHotFirePol EvaGreen qPCR Mix (Solis BioDyne #08-24-00020) and the following primers: hu_TNF_for: 5´CTCCACCCATGTGCTCCTCA3´, hu_TNF_rev: 5´CTCTGCCAGGGGCTCTTGAT3´, hu_IL1B_for: 5´GGCTGCTCTGGGATTCTCTT3´, hu_IL1B_rev: 5´AGTCATCCTCATTGCCACTGTAA3´, hu_IL6_for: 5´ACATCCTCGACGGCATCTCA3´, hu_IL6_rev: 5´TCACCAGGCAAGTCTCCTCATT3´, hu_IL10_for: 5´CAACAGAAGCTTCCATTCCA 3´, hu_IL10_rev: 5´AGCAGTTAGGAAGCCCCAAG3´, mu_Il1b_for: 5´CCAAAAGATGAAGGGCTGCTT3´, mu_Il1b_rev:5´ GGAAGGTCCACGGGAAAGAC3´, mu_Il6_for: 5´AAGAAATGATGGATGCTACCAAACTG3´, mu_Il6_rev: 5´GTACTCCAGAAGACCAGAGGAAATT3´, mu_Tgfb_for: 5´ACCCTGCCCCTATATTTGGA3´, mu_Tgfb_rev: 5´CGGGTTGTGTTGGTTGTAGAG3´, mu_Tnf_for: 5´CCATTCCTGAGTTCTGCAAAGG3´, mu_Tnf_rev: 5´AGGTAGGAAGGCCTGAGATCTTATC3´. The PCR was performed in a CFX96 touch™ Real-Time PCR detection system (BioRad). Data was normalized to the housekeeping gene RNA18S.

Equal amounts of total DNA were digested with DpnI to remove the input DNA and with an HPV18 genome-linearizing enzyme. The reaction mix was diluted, and 1 ng of total DNA was used in a single PCR, along with 300 nM forward and reverse primers, 2 μl of commercial master mix and 5x HOT FIREPol EvaGreen qPCR mix (Solis BioDyne) in a 10 μl total reaction volume. Amplification was performed on a 7900HT Real-Time PCR System (Applied Biosystems). The comparative threshold cycle (ΔΔC_t) method was used for the HPV genome quantification shown in Fig 1 by comparing HPV genome-specific signals to the signals of a reference (ribosomal DNA: rDNA) in the cellular genome. The change in the threshold cycle value (ΔC_t) of the sequence of interest (HPV, rDNA, and alpha-amylase (Amy)) was used to quantitate the relative amounts of newly synthesized DNA. The following primers were used: HPV18, GTGCATCCCAGCAGTAAG and AAACCAGCCGTTACAACC; rDNA, GCGGCGTTATTCCCATGACC and GGAATTGACGGAAGGGCACC; Amy, ACTCAAGGTAAGTAACAGCCCACGG and CTACACGTGGCTTGGTCACTTCATG.

In vitro differentiated and polarized HMDMs (polarized for 21 h) were treated for 7 h with 50 nM thioA or solvent control, respectively. Total RNA from treated cells was isolated using the High Pure RNA Isolation Kit (Roche #11828665001). Equal amounts of RNA were transcribed with the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific #4368813) in the presence of an RNase inhibitor (Invitrogen #10777-019) according to manufacturer’s instructions. cDNA was analyzed in qPCR using 5xHotFirePol EvaGreen qPCR Mix (Solis BioDyne, Tartu, Estonia, #08-24-00020) and the primers listed in Table 3. The PCR was performed in a CFX96 touch^™ Real-Time PCR detection system (Bio-Rad). Data were normalized to the housekeeping gene RNA18S.