U 1900 spectrophotometer

The FaDu and OECM‐1 cells were treated with or without CM of fBMFs for 30 days. The cells were seeded into 24‐well dishes coated with collagen type I for 40 min. Non‐adherent cells were removed by washing the dishes with PBS. Adherent cells were fixed with 100% methanol for 20 min and stained with 0.1% crystal violet for 30 min. After staining, the fixed cells were lysed in 30% acetic acid in water, and the absorbance was measured at 550 nm with a Hitachi U‐1900 spectrophotometer (Hitachi).²⁷

The RNA was isolated from each rat liver using TRIzol Reagent (Thermo Fisher Scientific, Waltham, MA), then, removing DNA contaminant using DNAse I treatment (Thermo Fisher Scientific, Waltham, MA) by following manufacturer’s protocol. The obtained RNA was then quantified with the aid of Hitachi-U1900 spectrophotometer (Hitachi, Tokyo, Japan) at 260 nm. ProtoScript First Standard cDNA Synthesis Kit (NEB) was used in converting purified DNA-free RNA into cDNA immediately. Also, OneTaq^® 2X Master Mix (NEB) was used in PCR amplification using the following primer set:
Hexokinase

Forward: GTGTACAAGCTGCACCCGA

Reverse: CAGCATGCAAGCCTTCTTG

Glucose-6-phosphatase

Forward: GCTCCGTGCCTCTGATAAA

Reverse: CCACGAAAGATAGCGAGAGTAG

The expression level of the genes studied was normalized by GADPH, and the band density was measured using ImageJ is plotted as a bar graph as illustrated by Elekofehinti et al. (2018 ).

The adsorption of Mo(VI) on Al₂O₃ from aqueous solutions of a given concentration (100–1000 mg/L) was carried out in a thermostated cell with a reflux condenser with nonstop mixing with a magnetic stirrer (150 rpm) at 298 K, 308 K and 318 K. The pH of the solution was varied using 1 M of the HCl solution and 1 M of the NaOH solution. The adsorption kinetics were studied by tracking changes in the concentration of Mo(VI) at different times at pH 4 and with initial concentrations of molybdenum at 100, 300, 500, 700 and 1000 mg/L. To determine the concentration of the Mo(VI) in an aqueous solution, a thiocyanate photometric method [49 (link)] was used, which was carried out by absorption at a wavelength of 470 nm using the Hitachi U-1900 spectrophotometer (Hitachi Ltd., Tokyo, Japan).
Equation (8) was used to estimate the amount of ions of metal adsorbed per 1 g of Al₂O₃ (mg/g): $$q_e=\frac{\left(C_0-C_e\right)·V}{m},$$
where $C_0$ and $C_e$ —initial and equilibrium concentration of Mo(VI) ions, mg/L, respectively; $V$ —volume of the solution, L; $m$ —the mass of the adsorbent, g.
The degree of the removal of Mo(VI), represented as $Adsorbed \left(Mo\right)$ (%), from solutions for different pH was calculated by Equation (11): $$Adsorbed \left(Mo\right)=\frac{\left(C_0-C_e\right)}{C_0}·100\%.$$

The antioxidant capacity of the olive oils was determined by Re et al.'s [22 (link)] method using 2,2′-azinobis-(3-ethyl-benzothiazoline-6-sulfonic acid) diammonium salt (ABTS, Sigma-Aldrich). The absorbance was measured on a Hitachi U-1900 spectrophotometer at 734 nm after 6 min of incubation in the dark at room temperature. For each olive oil, five parallel samples in three replicates were analyzed, from which the mean value was calculated. The antioxidant capacity was expressed as milligrams of Trolox per 1 liter of olive oil (mg Tx/L).

The antioxidant capacity of the olive oils was determined in extracts (1 g of olive oil and 9.3 mL n-hexane) by a standard DPPH method using 0.1 mM methanol solution of a 1,1-diphenyl-2-picrylhydrazyl (DPPH, Sigma-Aldrich) [20 (link)]. This method is widely used to test the antioxidant capacity of foods, including olive oils [21 (link)]. The absorbance was measured on a Hitachi U-1900 spectrophotometer at 517 nm after 30 min of incubation in the dark at room temperature. For each olive oil, five parallel samples in three replicates were analyzed, from which the mean value was calculated. The antioxidant capacity was expressed as milligrams of Trolox per 1 liter of olive oil (mg Tx/L).