Applied biosystems veriti 96 well thermal cycler

Influenza A virus RNA and coronavirus 229E RNA were purchased from the Korea Bank for Pathogenic Viruses (KBPV, Seoul, Republic of Korea) and their cDNA was synthesized using the cDNA synthesis kit. Forward and reverse primers for influenza A virus were synthesized as 5′‐GTCCAACCCTAAGTCCAA‐3′ and 5′‐GCCACAAAACACAACAATAC‐3′, respectively. Real‐time PCR was performed using the real‐time PCR master mix by QuantStudio 6 Flex real‐time PCR system (Life Technologies, Carlsbad, CA, USA) coupled with QuantStudio real‐time PCR software (v.1.1; Life Technologies). The real‐time PCR amplification conditions were as follows: 95°C predenaturation for 1 min, followed by 35 cycles of a denaturation at 95°C for 15 s, and extension at 60°C for 45 s. PCR was also performed using the PCR master mix by Applied Biosystems Veriti 96‐Well Thermal Cycler (Thermo Fisher Scientific). The amplification conditions were as follows: 95°C predenaturation for 1 min, followed by 35 cycles of a denaturation at 95°C for 15 s, and extension at 60°C for 45 s. The amplified PCR products were identified by electrophoresis using a 2% agarose gel.

The DNA samples were amplified with the primer pairs 16sf-var 5´-CAAATTACGCTGTTATCCCTATGG-3´ and 16sr-var 5´-GACGAGAAGACCCTAATGAGCTTT-3´ designed by Chapela et al. [20 ] using illustra^™ puReTaq Ready-To-Go^™ PCR Beads (GE Healthcare). For each tube containing the bead, 2 μl of 200 nM of each primer, 1 μl of 50 ng of template DNA and nuclease-free water (Life Technologies) were added, for a final reaction volume of 25 μl. DNA was amplified on an Applied Biosystems Veriti^™ 96 well Thermal Cycler (Thermo Fisher Scientific) with the following cycling program: denaturation at 94°C for 3 min; 35 cycles at 94°C for 40 s, 60°C for 40 s, and 72°C for 40 s; final extension at 72°C for 7 min. 5 μL of each PCR product was checked by electrophoresis on a 2% agarose gel and the presence of fragments of the expected length was assessed by a comparison with the standard marker O'GeneRuler DNA Ladder (Thermo Fisher Scientific). Double-stranded PCR products were purified with Agencourt^® AMPure^® XP Kit for DNA purification (Beckman Coulter, Beverly, Massachusetts, USA) on a DynaMag^™-2 magnet magnetic rack (Thermo Fisher Scientific) following the procedure proposed by the manufacturer. Purified PCR products were quantified using a Qubit^™ 3.0 Fluorometer (Thermo Fisher Scientific).

We analyzed patient DNA samples for mutations with the droplet digital PCR (ddPCR) method, on a QX100 system (Bio-Rad, Hercules, California, USA), according to manufacturer instructions. Briefly, we mixed 10 µl of 2x digital PCR Supermix for probes (Bio-rad), 2 µl primer/probe mix, 3 µl nuclease-free water, and 5 µl DNA (20 ng/µl), for a total volume of 20 µl. Droplets were generated on a QX100 Droplet Generator System (Bio-rad). The polymerase chain reaction (PCR) was performed with an initial stage at 95°C for 10 min, followed by 43 cycles of 94°C for 30 sec and 57°C for 60 sec, then a final stage at 98°C for 10 min. PCR was carried out on an Applied Biosystems Veriti 96-Well Thermal Cycler (Thermo Fisher, Waltham, MA, USA). Droplets were subsequently quantified on a QX100 Droplet Reader (Bio-rad) and analyzed with Quantasoft™ Analysis Pro software.
The JAK2V617F primer/probe assay included a forward primer: GCTTTCTCACAAGCATTTG, a reverse primer: GCATTAGAAAGCCTGTAGTTTTA, and two probes: Fam-TCGTCTCCACAGAaACATACTCCATGAGACGA-BHQ1 (mutant c.1849G>T) and Hex-TCGTCTCCACAGACACATACTCCATGAGACGA-BHQ1 (wildtype).

Polymerase chain reaction was performed on 16S rDNA gene using previously described primers and protocol [18 (link)]. For Anaplasma species, the forward primer ANAF 5′-TAGTGGCAGACGGGTGAGTA-3′ and a reverse primer ANAR 5′-AATTCCGAACAACGCTTGCC-3′ were used to yield an approximately 424 bp band, while for Ehrlichia species a forward primer EHRF 5′-AGCTGGTCTGAGAGGACGAT-3′ and a reverse primer EHRR 5′-GAGTGCCCAGCATTACCTGT-3′ targeting an approximately 838 bp of the 16S rDNA were used. Double-distilled water was used as the negative control. The PCR amplification reactions were performed in a thermal cycler (Applied Biosystems Veriti 96-Well Thermal Cycler, Thermo Fisher). The amplified products were electrophoresed using 1.5% agarose gel in Tris-borate-EDTA (TBE) buffer, pH 8, stained with ethidium bromide, and visualized using UV illuminator (UVP GelMax^® 125 Imager, USA). The sizes of the amplicons were determined using molecular ladder (GelPilot 1kb Plus Ladder (100), Qiagen, Germany). The resulting PCR amplicons were purified and Sanger sequenced at Macrogen Europe Laboratories (Amsterdam, the Netherlands) using the same forward and reverse primers as for the PCRs. The obtained sequences were viewed and manually verified using chromatogram peaks, edited, and assembled using CLC Main Workbench 6.8.3 Software (CLC Bio, Qiagen GmbH, Germany).

In order to confirm the unreported variants detected by Genexus, we performed an independent sequencing analysis using Ion S5 XL System.
The cDNA was prepared using 7 µl of viral RNA by Invitrogen™ SuperScript™ VILO™ cDNA Synthesis Kit (Thermo Fisher Scientific, San Diego, CA).
Libraries were prepared using the Ion AmpliSeq SARS-CoV-2 Research Panel according to the Ion AmpliSeq™ Library Kit 2.0 user guide (Thermo Fisher Scientific, MAN0006735 rev F.0) and all the reactions were performed in an Applied Biosystems™ Veriti™ 96-Well Thermal Cycler (Thermo Fisher Scientific, San Diego, CA). The final concentration of each cDNA library was determined on the Agilent 2100 system by the Agilent High Sensitivity DNA Assay (Agilent Technologies, Santa Clara, CA), following the manufacturer recommendations. Barcoded libraries were diluted to 30 pM, pooled in equal volume aliquots, and then loaded on to the Ion Chef™ Instrument (Thermo Fisher Scientific, San Diego, CA) for emulsion PCR, enrichment, and loading onto the Ion S5 520 chip. Two sequencing runs were performed on the Ion S5 XL System (Thermo Fisher Scientific, San Diego, CA). Reads were aligned with the Wuhan-Hu-1 NCBI Reference Genome (Accession number: MN908947.3) on the Torrent Suite v. 5.12.1.

Parental and stably transfected cells were washed with ice-cold phosphate-buffered saline (PBS). RNA was extracted using TRIzol^® reagent (Thermo Fisher Scientific) according to the manufacturer’s protocol. The RNA samples were dried and eluted in 10–30 µL of diethyl pyrocarbonate (DEPC)-treated water (Thermo Fisher Scientific). All preparative and handling procedures were performed under RNase-free conditions. The RNA concentration was measured using a Nanodrop™ 2000/2000c spectrophotometer (Thermo Fisher Scientific), and the total RNA samples were stored at −70 °C.
cDNA was synthesized using reverse transcription master mix (TaKaRa, Koyto, Japan; RR036A). PCR cycle, consisting of 37 °C for 15 min and 85 °C for 5 s, was performed using an Applied Biosystems Veriti^® 96-Well Thermal Cycler (Thermo Fisher Scientific). SsoAdvanced™ Universal SYBR^® Green Supermix (Bio-Rad, Hercules, CA, USA) was used for RT-PCR, and the level of RAD51 was compared following treatment with various drugs. GAPDH served as a control. PCR cycles consisted of 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s and were performed using a CFX96 Touch Real-Time PCR System (Bio-Rad). Following primers were used to qRT-PCR: GAPDH, Forward—CGACCACTTTGTCAAGCTCA; Reverse—AGGGGAGATTCAGTGTGGTG and RAD51, Forward—AGCTTTCAGCCAGGCAAAT; Reverse—GCTTCAGCTTCAGGAAGACA.