Prl sv40 renilla luciferase plasmid

BxPC3 cells were plated in a 96-well plate at a density of 3000 cells/well. After 12 h, the cells were transfected with 50 ng/well of Snail, Slug, CD44, or E-cadherin promoter-driven luciferase plasmids using lipofectamine (Invitrogen). Cells were simultaneously co-transfected with 50 ng/well of the pRL-SV40 Renilla luciferase plasmid (Promega) as an internal control. After 48 h, firefly and Renilla luciferase activities were measured with the Dual Luciferase kit (Thermo Fisher Scientific). The firefly luciferase signal was normalized to the Renilla luciferase signal to account for variations in transfection efficiency. All experiments were performed in triplicate, three independent times.

The sequences of p53 and CRE mutants on the Noxa promoter are the following: p53: 5′‐GAGAGTTTCCGGGAAGTTCGCG‐3′, CRE: 5′‐CTAAAAAA‐3′. Each promoter construct (−198 to +157 from the transcription start site) was cloned into KpnI‐BglII sites in PGV‐B2 (Toyo B‐Net, Tokyo, Japan). The ATF3 and ATF4 expression vectors were purchased from Addgene (Cambridge, MA, USA) (Wang et al., 2010). HN8 or HN12 cells (1 × 10⁵ cells/12 well) were transfected with 0.5 μg of reporter plasmids, 0.4 μg of an ATF3 expression plasmid, an ATF4 expression plasmid (wild‐type or deletion mutants) or an empty vector, and 0.1 μg pRL‐SV40 Renilla luciferase plasmid (Promega, Madison, WI, USA) using EndoFectin Max (GeneCopoeia). Luciferase activity was measured using the Dual‐Luciferase Reporter System (Promega) and normalized to the Renilla luciferase activity expressed by pRL‐SV40.

The DPYD promoter region, consisting of the 1154 bp of genomic DNA directly upstream of the DPYD TSS, was amplified by PCR, digested with EcoRV and HindIII (New England Biolabs), and cloned into compatible sites on the pGL4.10 vector (Promega). The 1392 bp region comprising the E9 region was PCR amplified from genomic DNA and cloned upstream of the DPYD promoter using KpnI and SacI sites (New England Biolabs). A vector containing the A allele of rs4294451 within E9 was confirmed by Sanger sequencing. The vector containing the rs4294451 T allele was generated by site-directed mutagenesis and confirmed by sequencing. All primers used in vector construction are listed in Supplementary file 1. For reporter assays, 10⁵ HEK293T cells were seeded into 24-well plates and co-transfected with pGL4.10-based plasmids and pRL-SV40 Renilla luciferase plasmid (Promega). After 48 hr, luciferase activity was measured using the Dual-Glo Luciferase Assay (Promega) following the manufacturer’s recommendations on a Synergy HTX Multimode Plate Reader (Agilent Technologies, Santa Clara, CA).

Cells were co-transfected with the B3GALT5-LTR firefly luciferase plasmid or the tandem repeat NFY response element RE on the pGL3 promoter vector and the pRL-SV40 Renilla luciferase plasmid, respectively (Promega). Cells were harvested 48 h post-transfection into 0.25 mL of the reporter lysis buffer and assayed for gene expression with the Dual-Luciferase Reporter Assay system (Promega, Madison, WI, USA). Firefly luciferase activity was normalized to Renilla luciferase activity, and the data are presented as the mean ± standard deviation of three independent experiments, each of which was performed in triplicate.

MEFs were co-transfected with pRL-SV40-Renilla luciferase plasmid (0.1 μg; Promega) and pGL4.10-Il31 (2 μg) in the presence of pcDNA-Epas1 or its mutants (2 μg). For transfection, these plasmid DNAs were mixed with Lipofectamine 2,000 transfection reagent (5 μl) in the Opti-MEM medium (500 μl; Life Technologies) for 20 min at room temperature, and the mixture was added drop-wise to MEFs (3 × 10⁵ cells per well) cultured in 1.5 ml of DMEM medium containing 1% FCS. 6 h after transfection, cells were suspended in DMEM containing 10% FCS and incubated for additional 24 h. In some experiments, pGL4.10-Il31-derived mutants were used. The total amount of plasmid DNA was equalized by the control vector. Luciferase activity was measured with a Dual-Luciferase Reporter Assay System according to the manufacture's protocols (Promega).