Gelred

Manufactured by Biosharp

Sourced in China

GelRed is a fluorescent dye used for nucleic acid staining in agarose gel electrophoresis. It binds to DNA and RNA, allowing for visualization of nucleic acid bands under UV or blue-light illumination.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (2 mentions) Hoechst 33342, by Thermo Fisher Scientific (2 mentions) Minibest agarose gel dna extraction kit v4, by Takara Bio (1 mentions) Dna sequencing, by Takara Bio (1 mentions) 7900 real time pcr system, by Thermo Fisher Scientific (1 mentions) Quantinova sybr green pcr kit, by Qiagen (1 mentions) Gel doc xr, by Bio-Rad (1 mentions) Nano zs90, by Malvern Panalytical (1 mentions) Ht7700, by Hitachi (1 mentions) Chemidoc xrs imaging system, by Bio-Rad (1 mentions) Cellmask green, by Thermo Fisher Scientific (1 mentions) Human serum albumin (hsa), by Merck Group (1 mentions) Magnesium chloride hexahydrate mgcl2 6h2o, by Sinopharm (1 mentions) Acetic acid, by Sinopharm (1 mentions) Agarose, by Sangon (1 mentions) Poly gel dna extraction kit, by Solarbio (1 mentions) Pmd18 t vector, by Takara Bio (1 mentions) Tianamp genomic dna kit, by Tiangen Biotech (1 mentions) Rnaprep pure tissue kit, by Tiangen Biotech (1 mentions) Gel extraction kit, by Transgene (1 mentions)

13 protocols using gelred

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time PCR was carried out using a QuantiNova SYBR Green PCR kit (QIAGEN, Shanghai, China) in accordance with the manufacturer's instructions and by using an initial denaturation step at 95°C for 2 min, followed by 40 cycles with 10 s denaturation at 95°C and 30 s annealing at 60°C. PCR was carried out in an Applied Biosystems 7900 Real-Time PCR system (AB Applied Biosystems, Foster City, CA) by standard melting curve analysis. Negative controls were prepared by adding distilled water instead of the DNA template. The identity of the PCR products was verified by electrophoresis in 2% agarose gels and stained with 1 μl GelRed (Biosharp, Shanghai, China). After assessing molecular weight, each PCR product was purified using the Takara MiniBEST Agarose Gel DNA Extraction Kit v4.0 (Takara, Shiga, Japan), following the manufacturer's protocol, and finally verified by DNA sequencing (Majorbio Company, Shanghai, China).
In all RT-PCR experiments, a 142-bp GAPDH fragment was amplified as a reference housekeeping gene using the intron spanning primers, GAPDH-347 (GCACCGTCAAGGCTGAGAAC) and GAPDH-488 (ATGGTGGTGAAGACGCCAGT). Data were analyzed using the comparative ΔΔCT method, which calculates the difference between threshold cycle (CT) values of the target and reference genes from each sample and then compares the resulting ΔCT values between different samples.

Zhang Y., Zhang Y., Zhao C., Yu T., Liu Y., Shi W., Shi F., Liu X., Sheng J., Huang H, & Xu H. (2017). Reduced alternative splicing of estrogen receptor alpha in the endometrium of women with endometriosis. Oncotarget, 8(66), 110176-110186.

+ Open protocol

+ Expand

Isolation and Characterization of Canine Gut Lactobacilli

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fecal samples were collected from canines after authorization from the owners.
Thirty healthy canines of different breeds [pomeranian (Pom), French bulldog
(FB), chihuahua (Chi), mongrel canines (MD), Shih Tzu (Shi), and poodle (PD)]
were sampled for feces to isolate LAB strains. Research involving the use of
animals was conducted in accordance with the guidelines of the Institutional of
Animals for Scientific Purposes Development (IAD), Thailand, under the reference
number U1-00263-2558. The fecal samples were serially diluted and spread onto
MRS agar plates supplemented with 0.1% CaCO₃, followed by
anaerobic incubation at 37°C for 24–48 h. Colonies exhibiting
clear halos were purified and subjected to evaluation for morphological and
biochemical characterization, following the method described by Schillinger and Lücke (1987) (link).
Amplification of the 16S rDNA was performed using a standard PCR protocol with
universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R
(5’-TACGGYTACCTTGTTACGACTT-3’; Stackebrandt and Goodfellow, 1991 ). The PCR products were separated
by electrophoresis on a 1% (w/v) agarose gel and visualized after
staining with GelRed (Biosharp, Anhui, China). Subsequently, the PCR products
were purified, and sequencing was carried out. Similar searches were performed
in GenBank using BLAST (http://www.ncbi.nlm.nih.gov/blast).

Foongsawat N., Sunthornthummas S., Nantavisai K., Surachat K., Rangsiruji A., Sarawaneeyaruk S., Insian K., Sukontasing S., Suwannasai N, & Pringsulaka O. (2023). Isolation, Characterization, and Comparative Genomics of the Novel Potential Probiotics from Canine Feces. Food Science of Animal Resources, 43(4), 685-702.

+ Open protocol

+ Expand

RNA Extraction and RT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of M/Ms was extracted with TRIzol® Reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol. Reverse transcription was performed with 500 ng of RNA in a 10-μL reaction solution of PrimeScriptTM RT Master Mix (Perfect Real Time) Sample (TaKaRa, Japan). PCR was performed with 28 cycles of denaturing (94 °C, 30 s), annealing (60 °C, 30 s), and extension (72 °C, 45 s), with a final extension at 72 °C for 7 min. PCR products were visualized by electrophoresis on a 1.5% (w/v) agarose gel containing 0.01% GelRed (Biosharp, Hefei, China) and imaged with a homemade fluorescence imaging system. Primer sequences were as follows: β-actin: forward primer 5′-GTGACGTTGACATCCGTAAAGA-3′ and reverse primer 5′-GCCGGACTCATCGTACTCC-3′; MMP3: forward primer 5′-TTGATGGGCCTGGAACAGTC-3′ and reverse primer 5′-AGTCCTGAGAGATTTGCGCC-3′; and MMP9: forward primer 5′-GGTCTTCCCCAAAGACCTGAAA-3′ and reverse primer 5′-GGGCACCATTTGAGTTTCCA-3′.

Qiao S., Qian Y., Xu G., Luo Q, & Zhang Z. (2019). Long-term characterization of activated microglia/macrophages facilitating the development of experimental brain metastasis through intravital microscopic imaging. Journal of Neuroinflammation, 16, 4.

+ Open protocol

+ Expand

Genotyping Mice by DNA Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mice were genotyped by DNA sequence and standard PCR. Primers were shown in supplementary materials (Supplementary Table S1). Agarose gel was prepared with 2% agarose and TAE (Leagene, Beijing, China). The PCR product was mixed with DNA loading buffer and Gelred (Biosharp, Anhui, China). After electrophoresis, the images were captured with GelDoc XR⁺ (Bio-Rad).

Zhang Z., Xu P., Hu Z., Fu Z., Deng T., Deng X., Peng L., Xie Y., Long L., Zheng D., Shen P., Zhang M., Gong B., Zhu Z., Lin J., Chen R., Liu Z., Yang H., Li R, & Fang W. (2022). CCDC65, a Gene Knockout that leads to Early Death of Mice, acts as a potentially Novel Tumor Suppressor in Lung Adenocarcinoma. International Journal of Biological Sciences, 18(10), 4171-4186.

+ Open protocol

+ Expand

Characterization of mRac1 Lipid Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA encapsulation by LNPs was evaluated by a gel retardation assay. The mRac1@LNPs were formulated at various weight ratios of total lipids to mRNA and were then electrophoresed on a 2% agarose gel in 1× TAE buffer at 100 V for 10 min. The mRNA was stained with Gel Red (Biosharp, China) and visualized with a ChemiDoc XRS⁺ imaging system (Bio–Rad, USA).
The particle size and zeta potential of mRac1@LNPs were analyzed using a Zetasizer Nano ZS90 instrument (Malvern, UK) after dilution with 1 × PBS. To observe the morphology of mRac1@LNPs, the mRac1@LNPs solution was deposited onto carbon TEM grids and imaged by TEM (HT7700, Hitachi, Japan).
The stability of mRac1@LNPs in vitro and in vivo was evaluated by size and PDI measurement. The particle size and PDI of mRac1@LNPs after incubation with 10% FBS at 37 °C or storage at 4 °C in PBS were analyzed as previously described. To test the biosafety of mRac1@LNPs in vivo, a hemolysis assay was conducted by incubation with red blood cells isolated from mice. The relative hemolysis of mRac1@LNPs or blank LNPs was analyzed based on normal saline as the negative control (0%) and 1% Triton X-100 as the positive control (100%).

Ma X., Tan X., Yu B., Sun W., Wang H., Hu H., Du Y., He R., Gao R., Peng Q., Cui Z., Pan T., Feng X., Wang J., Xu C., Zhu B., Liu W, & Wang C. (2022). DOCK2 regulates antifungal immunity by regulating RAC GTPase activity. Cellular and Molecular Immunology, 19(5), 602-618.

+ Open protocol

+ Expand

CyHV-2 DNA Detection in Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total DNA from each tissue was extracted using a Tissue DNA Purification Kit according to the manufacturer’s instructions (CWBio, Beijing, China). The extracted DNA was screened by PCR with CyHV-2 specific primers for viral DNA detection as described before [17 (link),18 (link)]. The PCR product was visualized in 1.5% agarose gel electrophoresis with Gel-Red (Biosharp, Hefei, China) staining.

Chai W., Qi L., Zhang Y., Hong M., Jin L., Li L, & Yuan J. (2020). Evaluation of Cyprinid Herpesvirus 2 Latency and Reactivation in Carassius gibel. Microorganisms, 8(3), 445.

+ Open protocol

+ Expand

DNA Origami Nanostructure Fabrication

Check if the same lab product or an alternative is used in the 5 most similar protocols

All reagents are commercially available and used without any further purification. P8064 DNA scaffold DNA was purchased from tilibit nanosystems^® GmbH (Garching, Germany). DNA staple strands were purchased from Wuhan GeneCreate Biological Engineering Co., Ltd. (Wuhan, China). Tris(hydroxymethyl)aminomethane and EthylenediaminetetraAcetic acid disodium salt were purchased from BEIJING LIUYI BIOTECHNOLOGY CO., LTD (Beijing, China). Acetic acid and Magnesium chloride hexahydrate (MgCl₂·6H₂O) were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Agarose and 5 × TBE for electrophoresis were purchased from Sangon Biotech Co., LTD (Shanghai, China). GelRed was purchased from biosharp. 1-Ethy-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC·HCl) and Human Serum Albumin (HSA) were purchased from Sigma-Aldrich. Hoechst33342 and Cell Mask Green were purchased from Thermo Fisher Scientific. Carbon grid was purchased from Beijing XXBR Technology Co., Ltd. (Beijing, China). Uranyl acetate solution was purchased from Beijing Zhongjingkeyi Technology Co., Ltd. (Beijing, China). Distilled water (18.2 MΩ·cm, MilliQ system) was used for all experiments.

Xu X., Fang S., Zhuang Y., Wu S., Pan Q., Li L., Wang X., Sun X., Liu B, & Wu Y. (2019). Cationic Albumin Encapsulated DNA Origami for Enhanced Cellular Transfection and Stability. Materials, 12(6), 949.

+ Open protocol

+ Expand

Microsatellite Analysis of Gibel Carp Strains

Check if the same lab product or an alternative is used in the 5 most similar protocols

Microsatellite DNA, also known as simple sequence repeats (SSR), consists of 1–6 base pairs of core sequences repeated in tandem, which has a random distribution throughout the entire genome (Zhou et al., 2001 (link)). In this study, fifteen pairs of microsatellite primers (Supplementary Table 2; Zhou et al., 2001 (link); Guo and Gui, 2008 (link)) that have been proved to be able to distinguish between strain F and strain A⁺ in gibel carp were used to explore the genetic contribution of the paternal individuals. PCR amplification was performed on thermocycler ETC811 (EastWin, China) in 20 μl Taq DNA Polymerase reaction mix using TsingKe^® Master Mix (TsingKe, China). PCR cycling conditions were performed as previously described (Zhou et al., 2001 (link); Guo and Gui, 2008 (link)). PCR products were electrophoresed on 8% polyacrylamide gel and stained with GelRed (Biosharp, China). The target microsatellite bands were obtained using Poly-Gel DNA Extraction Kit (Solarbio, China) as instructions described and transformed into the PMD18-T vector (Takara, Japan) for sequencing. 10 positive clones were sequenced for each sample and the sequences were analyzed by the DNAMAN software for homologous analysis.

Zhao X., Li Z., Ding M., Wang T., Wang M.T., Miao C., Du W.X., Zhang X.J., Wang Y., Wang Z.W., Zhou L., Li X.Y, & Gui J.F. (2021). Genotypic Males Play an Important Role in the Creation of Genetic Diversity in Gynogenetic Gibel Carp. Frontiers in Genetics, 12, 691923.

+ Open protocol

+ Expand

Molecular Diagnosis of Swine Pathogens

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA and DNA were extracted from the collected tissue samples using the RNAprep Pure Tissue Kit and the TIANamp Genomic DNA Kit (TIANGEN) according to the manufacturer's instructions. MHP, PCV2 with HPS and PRRSV were detected using nested PCR (N‐PCR), PCR and reverse transcription (RT)‐PCR. The primer sequences used in this study are listed in Table 1. The PCR products were analysed using gel electrophoresis on a 2% agarose gel in Tris‐acetic‐acid‐EDTA buffer and stained with GelRed™ (Biosharp, Hefei, China). The bands were visualised under ultraviolet illumination.

Yue W., Liu Y., Meng Y., Ma H, & He J. (2021). Prevalence of porcine respiratory pathogens in slaughterhouses in Shanxi Province, China. Veterinary Medicine and Science, 7(4), 1339-1346.

+ Open protocol

+ Expand

COBRA Analysis of Genomic Imprinting

Check if the same lab product or an alternative is used in the 5 most similar protocols

COBRA analysis was performed based on the methods as described (Hikabe et al. 2016 (link)). Genomic DNA was extracted using DNeasy Tissue Kit (QIAGEN) according to the manufacturer’s instructions. Bisulfite treatment of DNA was performed with the EpiTect Bisulfite Kit (QIAGEN). Bisulfite converted DNA was amplified by PCR, using HS Taq DNA Polymerase (QIAGEN) and primers (Table S6). Thermal cycling was carried out with a 10 min denaturation step at 94 °C, followed by 35 three-step cycles (30 s at 94 °C, 30 s at 55–58 °C and 30 s at 72 °C) and final incubation at 72 °C for 10 min. PCR products were recovered from stained gels (Gel Extraction Kit, Transgene). The amplified DNA was digested with the following restriction enzymes (NEB): AciI for Snrpn and Igf2r; PvuI-HF for Dlk1/Glt2; HpyCH4IV for H19/Igf2r and Mest1. The digested samples were resolved through electrophoresis in 1.5% agarose gels and illuminated by GelRed (BioSharp).

Tian C., Liu L., Zeng M., Sheng X., Heng D., Wang L., Ye X., Keefe D.L, & Liu L. (2021). Generation of developmentally competent oocytes and fertile mice from parthenogenetic embryonic stem cells. Protein & Cell, 12(12), 947-964.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!