Levels of mRNA expression were analysed using RT-PCR assay. Total RNA was isolated from HepG2 cells using an EASYspin Plus tissue/cell RNA extraction kit (Aidlab Biotechnologies Co. Ltd). RNA was quantified by measuring absorption at 260 nm, and 1 μg RNA was reverse transcribed to cDNA by using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Basel, Switzerland)46 (link). Thermal cycling conditions included an initial denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation (10 s at 95 °C), annealing (15 s at 60 °C) and extension (15 s at 72 °C with a single fluorescence measurement), a melting curve programme (60–95 °C with a 0.11 °C/s heat increase and continuous fluorescence measurement) and a cooling step to 40 °C. The Δ cycle threshold method was used for the calculation of the relative differences in mRNA abundance with a LightCycler 480 system (Roche Molecular Biochemicals, Mannheim, Germany). The data were normalized to the expression of β-actin. The results are expressed as fold changes. The RT-PCR primers used in this study are listed in Table S1 .
Easyspin plus tissue cell rna extraction kit
Manufactured by Aidlab
Sourced in China
The EASYspin Plus tissue/cell RNA extraction kit is a laboratory equipment product designed for the extraction and purification of RNA from various biological samples, including tissues and cells. The kit provides a simple and efficient method for isolating high-quality RNA for downstream applications such as gene expression analysis, RT-PCR, and other RNA-based experiments.
Automatically generated - may contain errors
Lab products found in correlation
Transcriptor first strand cdna synthesis kit, by Roche (5 mentions)
Lightcycler 480 system, by Roche (4 mentions)
Lightcycler 480 detector, by Roche (3 mentions)
Fast sybr green master mix, by Roche (2 mentions)
Thermoscript first strand cdna synthesis kit, by Aidlab (2 mentions)
Sybr green fluorescence, by Nippon Gene (2 mentions)
Hiscript q rt supermix kit, by Vazyme (2 mentions)
Lightcycler 480, by Roche (2 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Hiscript q rt supermix for qpcr, by Vazyme (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Kod plus neo dna polymerase, by Toyobo (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr kit, by Thermo Fisher Scientific (1 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (1 mentions)
14 protocols using easyspin plus tissue cell rna extraction kit
1
Quantification of mRNA Expression in HepG2 Cells
2
Quantitative RNA Analysis in RAW264.7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The methods for total RNA extraction and qRT-PCR have been described previously [44 (link)]. Total RNA was isolated from RAW264.7 cells by using an EASYspin Plus tissue/cell RNA extraction kit (Aidlab Biotechnologies Co. Ltd., Beijing, China). The amount of RNA was quantified by measuring absorption value at 260 nm and 1 μg RNA was reverse transcribed to cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Aidlab Biotechnologies Co. Ltd., Beijing, China). Thermal cycling conditions included an initial denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation (10 s at 95 °C), annealing (15 s at 60 °C) and extension (15 s at 72 °C with a single fluorescence measurement), a melting curve program (60–95 °C with a 0.11 °C/s heat increase and continuous fluorescence measurement) and a cooling step to 40 °C. The Δ cycle threshold method was adopted to calculate the relative differences in mRNA abundance with a LightCycler 480 system (Roche Molecular Biochemicals, Mannheim, Germany) [45 (link)]. The data were normalized to the expression of β-actin. The results are expressed as fold changes and the qRT-PCR primers used in this study are listed in Table 3 .
3
RNA Extraction, cDNA Synthesis, and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using an EASYspin Plus tissue/cell RNA extraction kit (Aidlab Biotechnologies, Co. Ltd.) according to the manufacturer's instructions. RNA was reverse-transcribed into cDNA using a Transcriptor First Strand cDNA Synthesis kit (Roche Diagnostics) following the manufacturer's instructions. qPCR was performed on a LightCycler 480 system (Roche Diagnostics) using Fast SYBR Green Master Mix (Roche Diagnostics) as per the manufacturer's instructions. The sequences of RT-qPCR primers were obtained as required and listed as following: GAPDH forward, 5′-CTTTGGTATCGTGGAAGGACTC-3′; reverse, 5′-GTAGAGGCAGGGATGATGTTCT-3′; lncRNA- ATB forward, 5′-TCTGGCTGAGGCTGGTTGAC-3′; reverse, 5′-ATCTCTGGGTGCTGGTGAAGG-3′; STAT3 forward, 5′-ACAGCAGGATGGCCAGGTTGC-3′; reverse, 5′-TCTGTCTGGTGGCTGCTGCCT-3′; E-Cadherin forward, 5′-AGCCATGTACGTTGCTATCC-3′; reverse, 5′-CGTAGCACAGCTTCTCCTTAAT-3′; Vimentin forward, 5′-GCTGCAGGCCCAGATTCA-3′; reverse, 5′-TTCATACTGCTGGCGCACAT-3′. The following thermocycling conditions were used for PCR: Initial denaturation at 95°C for 45 sec, followed by 40 cycles of 95°C for 10 sec and 52°C for 35 sec. The relative expression ratio of target genes was calculated using the 2−∆∆Cq method (19 (link)).
4
Transcriptional Profiling of Inflammatory Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells by the EASYspin Plus Tissue/Cell RNA Extraction Kit (Aidlab Biotechnologies Co., Ltd., Beijing, China) according to the manufacturer’s instructions. Purified RNA (1 μg) was reversely transcribed into complementary DNA using HiScript Q RT SuperMix for qPCR (VazymeBiotech Co., Ltd., Suzhou, China). qRT-PCR was performed on a LightCycler 480 Detector (Roche, Mannheim, Germany), and β-actin was selected as a housekeeping gene. The following primer sequences were used: β-actin: Forward primer TGATGGTGGGAATGGGTCAG, Reverse primer GGTGTGGTGCCAGATCTTCT; IL-1β: Forward primer GCAACTGTTCCTGAACTCAACT, Reverse primer ATCTTTTGGGGTCCGTCAACT; iNOS: Forward primer CCACAATAGTACAATACTACTTGG, Reverse primer ACGAGGTGTTCAGCGTGCTCCACG.
5
Semi-quantitative RT-PCR for NSD3 Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the cells using an EASYspin Plus Tissue/Cell RNA extraction kit (Aidlab Biotechnologies Co., Ltd., Beijing, China). RNA was reverse transcribed to cDNA using the ThermoScript First Strand cDNA Synthesis kit (Aidlab Biotechnologies Co., Ltd.) according to the manufacturer's instructions. Semi-quantitative reverse transcription-PCR was performed using KOD-Plus-Neo DNA polymerase (Toyobo Biotech Co., Ltd., Shanghai, China) to investigate the complete knockdown of NSD3. Each PCR regime consisted of initial denaturation at 94°C for 2 min followed by 22 cycles (for ACTB), 32 cycles (for NSD3) at 98°C for 10 sec, 55°C for 30 sec and 68°C for 45 sec. The primer sequences were: 5′-TTGGCTTGACTCAGGATTTA-3′ and reverse 5′-ATGCTATCACCTCCCCTGTG-3′ for β-actin (ACTB); and 5′-CCATGCAGAGAAAGCATTGA-3′ and 5′-TCTTCCTCTTCCGCACTTGT-3′ for NSD3. qRT-PCR was conducted using SYBR Premix Ex Taq™ (Takara, Dalian, China) at 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec and 60°C for 34 sec in the ABI StepOnePlus Real-time PCR system. Relative gene expression was quantified relative to the GAPDH level using the comparative cycle threshold (Ct) method. Each sample was analyzed in duplicate.
6
Gene Expression Analysis in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the EASYspin Plus tissue/cell RNA extraction kit (Aidlab, China) according to the manufacturer's protocol. One microgram of total RNA was reverse transcribed using the HiScript Q RT SuperMix kit (Vazyme, China). Quantitative PCR was then performed using TaqMan polymerase with SYBR Green fluorescence (Nippon Gene, Japan) on a LightCycler 480 Detector (Roche, Germany). Target gene threshold cycles (Ct values) were normalized to GAPDH as an endogenous control. Primer sequences: GAPDH forward, 5'-GAAAGCCTGCCGGTGACTAA-3' and reverse, 5'-AGGAAAAGCATCACCCG GAG-3'; Bax forward, 5'-CCAGAGGCGGGGTTTCAT-3' and reverse, 5'-CATCCTCTGCAGCTCCATGT-3'; Bcl2 forward, 5'-GAACTGGGGGAGGATTGTGG-3' and reverse, 5'-CATCCCAGCCTCCGTTATCC-3'); FASTKD2 forward, 5'-TCCTGAATCCCTAAACATGAAAA-3' and reverse, 5'-GCCATAACTTCCACGAACTG-3'; Caspase3 forward, 5'-GAAAGCCGAAACTCTTCATCAT-3' and reverse, 5'-ATGCCATATCATCGTCAGTTCC-3'.
7
Total RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the EASYspin Plus tissue/cell RNA extraction kit (Aidlab, China) according to the manufacturer's protocol. One microgram of total RNA was reverse transcribed using the HiScript Q RT SuperMix kit (Vazyme, China). Quantitative PCR was then performed using TaqMan polymerase with SYBR Green fluorescence (Nippon Gene, Japan) on a LightCycler 480 Detector (Roche, Germany). Target gene threshold cycles (Ct values) were normalized to GAPDH as an endogenous control. The primer sequences are listed in Table S2 .
8
Quantitative mRNA Expression Analysis by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Levels of mRNA expression were analyzed with the RT-PCR assay, with total RNA isolated from cells using an EASY spin Plus tissue/cell RNA extraction kit (Aidlab Biotechnologies Co. Ltd). RNA was quantified by measuring absorption at 260 nm and 1 μg of RNA was reverse transcribed to cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Basel, Switzerland). Thermal cycling conditions included 95 °C initial denaturation for 5 min, followed by 40 cycles of denaturation (10 s at 95 °C), annealing (15 s at 60 °C) and extension (15 s at 72 °C with a single fluorescence measurement), a melt curve program (60–95 °C with a 0.11 °C/s heat increase and continuous fluorescence measurement) and a cooling step to 40 °C. The Δ cycle threshold method was used for the calculation of relative differences in mRNA abundance with a Light Cycler 480 (Roche Molecular Biochemicals, Mannheim, Germany). The data were normalized to the expression of GAPDH. The results were expressed as fold-changes. The RT-PCR primers that were used in this study are listed in the supporting information.
9
Comprehensive mRNA and miRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For mRNA analysis, total RNA was isolated using EASYspin Plus tissue/cell RNA extraction kit (RN28; Aidlab, Beijing, China). First-strand synthesis was performed with the PrimeScript RT reagent kit (RR037A; Takara, Dalian, China). And qPCR was performed using SYBR Green reagent (ABI, Paisley, UK) in the ABI 7500 qPCR System. Reactions were performed twice in triplicate, and actin values were used to normalize gene expression. For miRNA analysis, total RNA was extracted using Trizol reagent (Invitrogen). Mature miRNAs were reverse transcribed (ABI), and qPCR was performed using TaqMan miRNA assays (ABI). U6 values were used to normalize miRNA expression. The list of primers used is provided in Supplementary Table S3 .
10
Quantifying Gene Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the cells and tissues through using an EASYspin Plus Tissue/Cell RNA Extraction Kit (Aidlab Biotechnology, Beijing, China). RNA was reversely transcribed to cDNA via a ThermoScript First Strand cDNA Synthesis Kit (Aidlab Biotechnology). A SYBR Green PCR Kit (Applied Biosystems, Shanghai, China) was utilized for qRT-PCR assays under the ABI-7900 system. A ΔΔCt method was employed to quantify targeted mRNA expression. GAPDH was always tested as the internal control and reference gene. The mRNA primers for NSD3 (full length), Prkaa2, Myc, Irgm1, Adam12, Notch3, and GAPDH were described in previous studies [13 (link), 19 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!