Taqman array mouse immune panel

Manufactured by Thermo Fisher Scientific

Sourced in United States

The TaqMan Array Mouse Immune Panel is a pre-configured array of TaqMan Gene Expression Assays designed to profile the expression of 96 key genes involved in the mouse immune response. It enables efficient and accurate gene expression analysis of mouse immune system-related genes.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

TaqMan Mouse Immune Array (4 citations) TaqMan Arrays (3 citations)

4 protocols using taqman array mouse immune panel

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Prior to extraction of RNA using a RNeasy spin column (Qiagen), blood from the posterior vena cava was treated with red blood cell lysis buffer and lung tissues were treated with RNAlater solution (Ambion). All samples were DNase I treated (Qiagen) on the column during purification. For examination of SA100A8 transcripts, qRT-PCR analyses were performed using a SuperScript III One-Step RT-PCR kit (Thermo Fisher Scientific) on a QuantStudio 7 Real-Time Cycler (Thermo Fisher Scientific). Transcription levels of genes analysed were normalized to those obtained for ACTB. Data represent the mean (± S.E.M.) of two independent experiments with treatment cohorts comprised of at least six mice. The examination of mouse immune markers by qPCR was conducted using the TaqMan Array Mouse Immune Panel (Thermo Fisher Scientific) on a QuantStudio 7 Real-Time Cycler (Thermo Fisher). The TaqMan Arrays analyses were performed in triplicate, with each sample representing RNA pools from at least three mice. The results were analysed using the ThermoFisher Cloud Software. For the TaqMan Arrays analyses, data represent the mean (± S.E.M.), with statistical analyses performed using a one-way ANOVA.

Eijkelkamp B.A., Morey J.R., Neville S.L., Tan A., Pederick V.G., Cole N., Singh P.P., Ong C.L., Gonzalez de Vega R., Clases D., Cunningham B.A., Hughes C.E., Comerford I., Brazel E.B., Whittall J.J., Plumptre C.D., McColl S.R., Paton J.C., McEwan A.G., Doble P.A, & McDevitt C.A. (2019). Dietary zinc and the control of Streptococcus pneumoniae infection. PLoS Pathogens, 15(8), e1007957.

+ Open protocol

+ Expand

Immune Expression Profiling of Kidney

Check if the same lab product or an alternative is used in the 5 most similar protocols

The TaqMan Array Mouse Immune Panel (Thermo Fisher Scientific, Waltham, MA, USA) was used to determine the immune expression profile of the kidney.

Mishima E., Ichijo M., Kawabe T., Kikuchi K., Akiyama Y., Toyohara T., Suzuki T., Suzuki C., Asao A., Ishii N., Fukuda S, & Abe T. (2020). Germ-Free Conditions Modulate Host Purine Metabolism, Exacerbating Adenine-Induced Kidney Damage. Toxins, 12(9), 547.

+ Open protocol

+ Expand

Achilles Tendon Immune Response

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from Achilles tendons using Trizol/chloroform. cDNA was synthesized by reverse transcription using the SuperScript VILO master mix (Cat. # 11755050, Invitrogen). The TaqMan Array Mouse Immune Panel (Cat. # 4414079, Thermo Fisher) with Taqman Fast Advanced Master Mix (Cat. # 4444556, Thermo Fisher) was used to screen 92 genes related to immune response. Gene expression was normalized to Gapdh and analysed using the 2−ΔΔCt method relative to uninjured control tendons. qPCR was carried out by Mount Sinai’s core facilities using SYBR PCR Master Mix (Cat. # 4309155, Thermo Fisher) and gene expression calculated using the 2^−ΔΔCt method relative to Gapdh and carrier-treated control tendons at D3. Primers for Il1β (FWD: AGTTGACGGACCCCAAAAGAT; REV: GTTGATGTGCTGCTGCGAGA) and Il10 (FWD: ATTTGAATTCCCTGGGTGAGAAG; REV: CACAGGGGAGAAATCGATGACA) were used. Tendon gene primers were previously described (7 (link)).

Howell K.L., Kaji D.A., Li T.M., Montero A., Yeoh K., Nasser P, & Huang A.H. (2021). Macrophage depletion impairs neonatal tendon regeneration. FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 35(6), e21618.

+ Open protocol

+ Expand

Tumor Immune Landscape Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tumor samples collected and stored in RNAlater solution (Thermo Fisher) were mechanically disrupted using TRIzol reagent (Invitrogen). RNA was purified by phenol/chloroform extraction and then loaded onto RNeasy MINI or MICRO kits (Qiagen) with on-column DNAse treatment. RNA purity and yield were assessed using NanoDrop spectrophotometer. RNA was reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher). The TaqMan® Array Mouse Immune Panel (Thermo Fisher) was used to evaluate the tumor immune landscape following the manufacturer’s instruction.

Cascini C., Ratti C., Botti L., Parma B., Cancila V., Salvaggio A., Meazza C., Tripodo C., Colombo M.P, & Chiodoni C. (2023). Rewiring innate and adaptive immunity with TLR9 agonist to treat osteosarcoma. Journal of Experimental & Clinical Cancer Research : CR, 42, 154.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!