Superscript first strand synthesis

30x10⁶ cells were homogenised in 10 mL of 3M LiCl, 6M urea and 0.2% SDS and kept at 4°C overnight. Samples were vortexed and spun at 17900 x g for 20 minutes at 4°C. The supernatant was discarded and the pellet was dissolved in 2.5 ml of TES (10 mM Tris-HCl, pH 7.6; 1mM EDTA, pH 8.0; 0.5% SDS). 2.5 mL phenol (pH 4) were added and after agitating vigorously, the samples were centrifuged at 960 x g for 10 minutes. The upper phase was transferred to a new RNAse-free tube and 1/10 volume sodium acetate and 2.2 volumes ethanol were added. Samples were kept at—20°C overnight and were then spun down at 20800 x g for 30 minutes at 4°C. Supernatant was discarded, pellet was air-dried at room temperature and dissolved in TES. RNA quality was verified by agarose gel electrophoresis. cDNA was synthesised using Superscript First-Strand Synthesis (Invitrogen #11904–018), 3 μg of total RNA and oligo(dT). Manufacturer’s instructions were followed. Coding sequences of Aurora B, Survivin and Borealin were amplified from cDNA of HDLM2, KMH2 and L428 cell lines and sequenced. Primers used for amplification were: Aurora B—5' GCCCAGAAGGAGAACTCC3' and 5' CCTTCAATCTGTCGCCT3'; Survivin—5' CCCTTTCTCAAGGACCACC3' and 5' AGCCACTGTTACCAGCAGC3'; Borealin—5'GGGGCTCGAGACATGGCTCCTAGGAAGGGC3' and 5' GGGCGGTACCCCTTTGTGGGTCCGTATGCT3'.

For RNA isolation, coral fragments were ground in liquid nitrogen using a mortar and pestle. Total RNA was extracted from ~ 500 mg of the homogenized sample using RNeasy Plant Mini Kit according to the manufacturer’s instructions (Qiagen, Germany). After digestion of genomic DNA, RNA samples were examined by PCR to ensure no DNA contamination was presented and then quantified by ND-1000 UV–Vis Spectrophotometer (ThermoFisher Scientific, USA). For reverse-transcription, purified RNA was converted to cDNA with random hexameters primer using the SuperScript First-Strand Synthesis (Invitrogen, USA) according to the manufacturer’s protocol. The cDNA samples were quantified using a Qubit 2.0 Fluorometer (Invitrogen, Carlsbad, CA) and cDNA quality was checked on a 0.8% agarose gel. The resulting RNA and cDNA were stored at − 80 °C until further use.

RNA was collected from T1 and T2 cell cultures polarized for 5 days using TRIreagent and complementary DNA synthesized using SuperScript First Strand Synthesis (ThermoFisher). Quantitative real time PCR measured expressed RNAs using SYBR green master mix (Applied Biosystems). RNA levels were standardized relative to the housekeeping gene GAPDH. Patient samples containing definite outliers (ROUT with Q=0.1% by GraphPad Prism software) were removed. Patient samples with both T1 and T2 available were included for analysis.
For RNA sequencing, RNA was collected by TRIreagent followed by DNase digestion. Library preparation was performed with the Illumina Tru-Seq Stranded RNA kit. RNA sequencing was performed with an Illumina HiSeq2500 instrument by the Vanderbilt Technologies for Advanced Genomics (VANTAGE) core facilities consecutively on all samples. 100bp paired end reads were generated. Average sequencing depth of all samples was 43 million mapped reads ± 13.5 million (standard deviation). FASTQ files were processed using DESeq2 to identify differentially expressed genes (33 (link)). Data are available in NCBI’s Gene Expression Omnibus (34 (link)) with GEO series accession number GSE185193. GO Enrichment analysis for overrepresented biological processes was performed using the Gene Ontogeny Resource (35 (link)–37 (link)).

Total RNA isolated from Leishmania parasites was treated with RNase free DNase (PureLink RNA mini kit, Ambion). First strand cDNA synthesis was performed with 500 ng of DNase treated RNA (SuperScript first strand synthesis, Thermofisher) followed by RNaseH treatment. PCR performed with the resulting cDNA using primers corresponding to folate/biopterin transporter or gp63 genes. Only a partial open reading frame is amplified in the PCR.

Total RNA was isolated using commercially available kits according to manufacturer guidelines (RNeasy Mini, Qiagen) and measured (Nanodrop, Peqleb). One μg was used in a reverse transcription reaction (SuperScript First strand synthesis, Thermofisher). Quantitative-PCR was performed using Quantifast SYBR Green PCR Kit (Qiagen), reactions were performed in triplicate. Transcript levels were calculated using the standard curves generated using serial dilutions of cDNA obtained by reverse transcription of control RNA samples then normalized to HPRT. Primer sequences were listed in supplementary Table S15. Amplification specificities were assessed by melting curve analyses and amplicons were sequenced. Values correspond to the mean of 3 independent experiments in triplicates of three control cultures and the RNS patient cultures. Data represent mean fold gene expressions ± s.d. relative to control. Data were analyzed via two-way ANOVA with Bonferroni multiple comparisons test (*p < 0.05, **p < 0.01, ***p < 0.001).