Genome was analyzed by qualitative PCR and RFLP using gene specific primers. PCR amplification was carried out in a 25 μL reaction volume containing 2× master mix red 1.5 mM MgCl2 (Ampliqon, Odense, Denmark), 10 pmol/μL of forward and reverse primer and 10 μL of the extracted DNA as template. This reaction mixture was amplified at 94°C for 5 minutes and for 40 cycles in a thermal cycler (Techne, Staffordshire, UK) under the following conditions: 94°C for 45 seconds, 60°C for 45 seconds, 72°C for 50 seconds, plus a final extension step at 72°C for 10 minutes. Each experiment was performed with distilled water as a negative PCR control and patients with known genome as positive control. In RFLP analysis, 10 μL of JAK2 PCR product was digested with 20 μL restriction enzyme reaction containing 16 μL sterile distilled water, 3 μL enzyme buffer and Bsax1 (2,000 U/μL) enzyme (New England Biolabs®, Ipswich, MA, USA). The PCR-RFLP products were separated by electrophoresis on a 3% agarose gel, stained by Sybr safe (Invitrogen, Carlsbad, CA, USA), and were visualized under ultraviolet light along with a molecular weight marker (50 bp). In a JAK2 V617F (1849 G > T) PCR-RFLP reaction was expected to produce 364 bp as undigest, 161 and 203 bp as wild type, 364, 203, 161 bp as heterozygous and 364 bp as homozygous.20
Mgcl2
Manufactured by Ampliqon
Sourced in Denmark
MgCl2 is a chemical compound that is widely used in various industrial and scientific applications. It is a white, crystalline solid that is soluble in water and other polar solvents. MgCl2 is commonly used as a source of magnesium ions in various chemical processes and formulations.
Automatically generated - may contain errors
Lab products found in correlation
Taq dna polymerase 2 master mix red, by Ampliqon (2 mentions)
Sybr safe, by Thermo Fisher Scientific (1 mentions)
Taq dna polymerase master mix, by Ampliqon (1 mentions)
Safe stain, by Sinaclon (1 mentions)
Taq dna polymerase 2.0 master mix red, by Ampliqon (1 mentions)
Taq dna polymerase, by Ampliqon (1 mentions)
Thermocycler, by Thermo Fisher Scientific (1 mentions)
Taq dna polymerase 2 master mix, by Ampliqon (1 mentions)
Gel documentation system, by Uvitec (1 mentions)
7 protocols using mgcl2
1
Qualitative PCR and RFLP Analysis of JAK2 V617F
2
Nested-PCR Detection of Toxoplasma gondii
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR was conducted using a pair of T. gondii-specific primers:
GAR6-F1: 5'-ATTTGTGTTTCCGAGCAGGT-3' and
R1: 5'-GCACCTTCGCTTGTGGTT-3'.
Nested-PCR was performed with primers:
GAR6-F2: 5'-TTTCCGAGCAGGTGACCT-3' and
R2: 5'-TCGCCGAAGAGTTGACATAG-3' (20 (link)).
Amplifications were conducted ina final volume of a 20 μL reaction mixturethat contained 10 μL of 2x Taq DNA polymerase Master Mix with 2 mM MgCl2 (Cat. no. A170301, Ampliqon, Denmark), 10 pmol of each primer, 5 μL of distilled water, and 3 μL of template DNA. For nested-PCR, one μL of the first round PCR product was used as the template. For each reaction, two positive controls (DNA extracted from T. gondii paraffin-embedded tissuesand the RH strain of T. gondii) and a negative control (double distilled water) were included. Amplification was performed with initial denaturation for 5 minutes at 95°C, followed by 35 cycles at 95°C for 30 seconds (denaturation), annealing at 59°C in the first round, and 57°C in nested PCR for 30 seconds, extension at 72°C for 30 seconds, and final extension at 72°C for 10 minutes. A total of 5 μl of nested-PCR products along with a 100-bp DNA ladder were electrophoresed in 1.5% safe stain (Sinaclon, Iran) agarose gels and visualized under ultra-violet trans-illumination.
GAR6-F1: 5'-ATTTGTGTTTCCGAGCAGGT-3' and
R1: 5'-GCACCTTCGCTTGTGGTT-3'.
Nested-PCR was performed with primers:
GAR6-F2: 5'-TTTCCGAGCAGGTGACCT-3' and
R2: 5'-TCGCCGAAGAGTTGACATAG-3' (20 (link)).
Amplifications were conducted ina final volume of a 20 μL reaction mixturethat contained 10 μL of 2x Taq DNA polymerase Master Mix with 2 mM MgCl2 (Cat. no. A170301, Ampliqon, Denmark), 10 pmol of each primer, 5 μL of distilled water, and 3 μL of template DNA. For nested-PCR, one μL of the first round PCR product was used as the template. For each reaction, two positive controls (DNA extracted from T. gondii paraffin-embedded tissuesand the RH strain of T. gondii) and a negative control (double distilled water) were included. Amplification was performed with initial denaturation for 5 minutes at 95°C, followed by 35 cycles at 95°C for 30 seconds (denaturation), annealing at 59°C in the first round, and 57°C in nested PCR for 30 seconds, extension at 72°C for 30 seconds, and final extension at 72°C for 10 minutes. A total of 5 μl of nested-PCR products along with a 100-bp DNA ladder were electrophoresed in 1.5% safe stain (Sinaclon, Iran) agarose gels and visualized under ultra-violet trans-illumination.
3
Genotyping of Candida albicans Isolates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genotyping of C. albicans isolates was carried out by amplifying the 25S rDNA gene with specific primers CAINT‐L (5′‐ATAAGGGAAGTCGGCAAAATAGATCCGTAA‐3′) and CA‐INT‐R (5′‐CCTTGGCTGTGGTTTCGCTAGATAGTAGAT‐3′) 13. Briefly, Taq DNA Polymerase 2× Master Mix RED with 1.5 mM MgCl2 (Ampliqon), 0.5 μM of each primer, and 2 μl genomic DNA in a total volume of 25 μl. PCR products were amplified under the following conditions: 97°C for 7 min, 35 cycles at 94°C for 30 s, 60°C for 30 s, 72°C for 40 s, and 72°C for 5 min as the final extension. The PCR products were visualized on 1.5% agarose gel. A 450 bp band represented type A, 840 bp type B, 450 and 840 bp type C, 1040 bp type D, and 1080 bp type E. Types D and E correspond to C. dubliniensis.
4
Multiplex PCR for Staphylococcus Enterotoxins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The presence of classical enterotoxin genes, sea, seb, sec, sed, and see (Table 1 ; Barati et al., 2006 ) among the Staphylococcus isolates obtained, was investigated employing a multiplex PCR assay as previously described by Omoe et al. (2005 (link)). The reaction mixture (50 μl) containing 0.1 µM of each primer, 50–100 ng genomic DNA, and 25 μl of Taq DNA polymerase 2.0× Master Mix RED was used (1.5 mM MgCl2; Ampliqon). Staph. aureus reference strains, Staph. aureus DSM 19,040 (SEC, SEE) and Staph. aureus DSM 19,041 (SEA, SEB, SED), were used as enterotoxin producers (Rahmdel et al., 2018 (link)). The products of PCR were detected by electrophoresis in a 1.4% agarose gel in TAE (1×).
5
Multiplex PCR and Sanger Sequencing for cox1 Gene Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To verify the multiplex PCR resulting from genotyping, 59 samples were selected to sequence the gene target of cox 1 randomly from the cysts obtained from all various species of animals. The PCR reaction was conducted using a thermal cycler (ABI, USA) in a 20 μl final volume containing 50–100 ng gDNA, 0.2 mM dNTPs (Ampliqon, Denmark), 1.5 mM MgCl2 (Ampliqon, Denmark), 10 pmol of each primer (ordered from Pishgam Company), 1.5 U Taq DNA polymerase, and ddH2O up to the final volume. Amplification was done using the specific primer pair for cox 1 by JB3: 5′-TTTTTTGGGCATCCTGAGGTTTAT-3′ and JB4.5: 5′-TAAAGAAAGAACATAATGAAAATG-3′ [84 (link)] resulted in an amplicon fragment of 450 bp in length. The temperature conditions were an initial denaturation at 94 °C for 5 min; then 35 cycles of denaturation at 94 °C for 45 s, annealing at 57 °C for 45 s, and elongation at 72 °C for 45 s. The final extension was done at 72 °C for 5 min. PCR products were detected in 1% agarose gel electrophoresis (Akhtarian, Tehran, Iran). The PCR product was excised from agarose gel, and sent to the Company (Pishgam Company, Tehran, Iran) for purification and sequencing. The sequencing results were analyzed using BLAST.
6
Genotyping of Candida albicans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ABC genotyping was carried out with 1 μL template DNA, 12.5 μl Taq DNA Polymerase 2× Master Mix RED with 1.5 mM MgCl2 (Ampliqon), and 5 pmol of both CAINT‐L (5′‐ATAAGGGAAGTCGGCAAAATAGATCCGTAA‐3′) and CAINT‐R (5′‐CCTTGGCTGTGGTTTCGCTAGATAGTAGAT‐3′) primers.24 , 25 The PCR cycling conditions were as follows: initial denaturation at 94°C for 5 min, followed by 25 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, with a final extension at 72°C for 7 min. Ten microliters of each PCR product was separated by electrophoresis on 1.5% agarose gel. Candida albicans isolates can be separated into three genotypes depending on the presence or absence of an intron in the internal transcribed spacer 1 (ITS1) region of 26 s rDNA. According to the PCR products, the genotypes of C. albicans can be categorized as group A (450 bp), group B (840 bp), and group C (450 and 840 bp).
7
Detection of ESBL-Associated Genes by PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ESBL-producing isolates were subjected to polymerase chain reaction (PCR) for detection of bla OXA , bla PER-1 bla VEB-1 , and bla GES-1 genes using the specific primers listed in Table 1 [18] [19] [20] [21] [22] [23] [24] . Total deoxyribonucleic acid (DNA) was extracted from bacterial isolates using an extraction kit (Bioneer, Daejeon, Korea). PCR amplification was performed in a thermocycler (Applied Biosystems, Carlsbad, CA, USA) as follows: 96 o C for 5 min; 35 cycles of 1 min at 96 o C, 1 min at a specific temperature for each primer, and 1 min at 72 o C; and a final extension step of 10 min at 72 o C. Amplification reactions were prepared in a total volume of 25μl including 12.5μl Taq DNA polymerase 2× Master Mix with 1.5mM MgCl 2 (Ampliqon, Odense, Denmark), 0.5μM forward primer, 0.5μM reverse primer, 9μl nuclease free water, and 2.5μl DNA template (50pg concentration). PCR products were electrophoresed on a 1% agarose gel at 100V, stained with ethidium bromide solution, and finally visualized with a gel documentation system (UviTec, Cambridge, UK). Purified PCR products were sequenced by the Macrogen Company (Seoul, Korea), and sequence alignment and analysis were performed online using the basic local alignment search tool (BLAST) program of the National Center for Biotechnology Information (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!