Real-time qPCR (RT-qPCR) was used to determine the levels of Hotairm1 in exosomes, Gr1+CD11b+ cells, or S100A9 immunoprecipitates. Exosomes were purified from plasma or cell culture supernatants, and exosomal RNA was isolated using exoRNeasy Starter Kit (Qiagen). Total cellular RNA was isolated from Gr1+CD11b+ cells using TRIzol reagent (Invitrogen). Levels of Hotairm1 expression were measured using QuantiTect PCR Mastermix and RT2 lncRNAqPCR Assay primers (Qiagen). The expression level was calculated using the 2−ΔΔCt cycle threshold method. Values were normalized to GAPDH RNA for total RNA or 18S RNA for exosomal RNA, amplified with QuantiTect Primer Assays. The PCR was performed in duplicate.
Rt2 lncrnaqpcr assay
Manufactured by Qiagen
Sourced in China
The RT2 lncRNAqPCR Assay is a laboratory equipment product designed for the analysis of long non-coding RNA (lncRNA) expression. It provides a platform for the quantitative real-time PCR (qPCR) detection and measurement of lncRNA levels in biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Quantitect pcr mastermix, by Qiagen (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Exorneasy starter kit, by Qiagen (2 mentions)
Rt2 sybr green mastermix, by Qiagen (2 mentions)
Rt2 first strand kit, by Qiagen (2 mentions)
Abi 7500 rt pcr system, by Thermo Fisher Scientific (2 mentions)
Miscript sybr green pcr kit, by Qiagen (1 mentions)
Hs actb 1 sg quantitect primer assay, by Qiagen (1 mentions)
5 protocols using rt2 lncrnaqpcr assay
1
Quantifying Hotairm1 in Exosomes and Cells
2
Sensitive lncRNA Detection in Patient Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used primers and detection reagents purchased from QIAGEN (China) to detect lncRNAs in our patient samples. Only RNase-free water was used throughout the assays. We first used the RT2 First Strand Kit (QIAGEN, China) for the synthesis of cDNA. This kit ensures complete elimination of genomic DNA. The starting amount of RNA was 1 μg to which 2 μL of genomic DNA elimination mix was added and mixed by pipetting, followed by incubation for 5 min at 42°C and then immediate transfer to ice for 1 min. Reverse transcription mix, consisting of 5× buffer and Reverse Transcriptase, was prepared exactly as suggested and added to the tube containing RNA. This was incubated for 15 min at 42°C and then the reaction stopped by transfer for 5 min to 95°C.
The RT2 lncRNA qPCR assay (QIAGEN, China) was used for the detection of lncRNAs. The product from the RT2 First Strand step was mixed with RT2 SYBR Green Master Mix (QIAGEN, China) and run on an ABI 7500 RT-PCR system (Applied Biosystems) with the following PCR cycle conditions: 1 cycle—10 min/95°C, followed by 40 cycles consisting of two steps—15 s/95°C and 1 min/60°C.
The RT2 lncRNA qPCR assay (QIAGEN, China) was used for the detection of lncRNAs. The product from the RT2 First Strand step was mixed with RT2 SYBR Green Master Mix (QIAGEN, China) and run on an ABI 7500 RT-PCR system (Applied Biosystems) with the following PCR cycle conditions: 1 cycle—10 min/95°C, followed by 40 cycles consisting of two steps—15 s/95°C and 1 min/60°C.
3
Quantification of ANPCII, lncRNA-RP11, and miR106b-5p
Check if the same lab product or an alternative is used in the 5 most similar protocols
ANPCII mRNA and lncRNA-RP11-175K6 expressions in sera samples were quantified by using QuantiTect SYBR Green PCR Kit and RT2 SYBR Green ROX qPCR Mastermix, sequentially. RT2 lncRNA qPCR Assay for Human lncRNA-RP11-175K6.1(LOC101927740 (ENST00000499 583) and ANPCII QuantiTect Primer Assay (NM_ 001002244), Hs_ACTB_1_SG QuantiTect Primer Assay (NM_001002244) [that was used as housekeeping gene in equalization of raw data] were purchased from Qiagen, Germany.
We used miScript SYBR Green PCR Kit (Qiagen /SABiosciences Corporation, Frederick, MD) for quantification of hsa-_ miR106b-5p expression in different sera samples using either Hs_ miR106_1 miScript Primer Assay targets mature miRNA: hsa- miR106 - MIMAT0000680: 5'UAAAGUGCUGACAGUGCAGAU and snord68 that was used as housekeeping gene, Each reaction was done in duplicate. Relative quantification of RNAs expression was calculated by using the method of Leviak RQ= 2-ΔΔCt method [19 (link)].
Data analysis was performed using the Rotor Gene real time PCR (Qiagen, Hilden, Germany) which is considered negative if higher than 36 Ct value.
+ Expand
ANPCII mRNA and lncRNA-RP11-175K6 expressions in sera samples were quantified by using QuantiTect SYBR Green PCR Kit and RT2 SYBR Green ROX qPCR Mastermix, sequentially. RT2 lncRNA qPCR Assay for Human lncRNA-RP11-175K6.1(LOC101927740 (ENST00000499 583) and ANPCII QuantiTect Primer Assay (NM_ 001002244), Hs_ACTB_1_SG QuantiTect Primer Assay (NM_001002244) [that was used as housekeeping gene in equalization of raw data] were purchased from Qiagen, Germany.
We used miScript SYBR Green PCR Kit (Qiagen /SABiosciences Corporation, Frederick, MD) for quantification of hsa-_ miR106b-5p expression in different sera samples using either Hs_ miR106_1 miScript Primer Assay targets mature miRNA: hsa- miR106 - MIMAT0000680: 5'UAAAGUGCUGACAGUGCAGAU and snord68 that was used as housekeeping gene, Each reaction was done in duplicate. Relative quantification of RNAs expression was calculated by using the method of Leviak RQ= 2-ΔΔCt method [19 (link)].
Data analysis was performed using the Rotor Gene real time PCR (Qiagen, Hilden, Germany) which is considered negative if higher than 36 Ct value.
4
Detecting lncRNAs using Qiagen Reagents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers and detection reagents were purchased from Qiagen (China) to detect lncRNAs in samples. Only RNAse-free water was used throughout the assays. RT2 First Strand Kit (Qiagen, China) was used for the synthesis of cDNA to eliminate genomic DNA. The starting amount of RNA was 1 μg to which 2 μl of genomic DNA elimination mix was added and mixed by pipetting, followed by incubation for 5 min at 42°C and then immediate transfer to ice for 1 min. Reverse transcription mix, consisting of 5× buffer and Reverse Transcriptase, was prepared exactly as suggested and added to the tube containing RNA. This was incubated for 15 min at 42°C and then the reaction stopped by transfer for 5 min to 95°C.
RT2 lncRNA qPCR assay (Qiagen, China) was used for the detection of lncRNAs. The product from RT2 First strand step was mixed with RT2 SYBR green mastermix (Qiagen, China) and run on an ABI 7500 RT-PCR system (Applied Biosystems) with the following PCR cycle conditions—1 cycle—10 min/95°C, followed by 40 cycles consisting of two steps—15 s/95°C and 1 min/60°C.
RT2 lncRNA qPCR assay (Qiagen, China) was used for the detection of lncRNAs. The product from RT2 First strand step was mixed with RT2 SYBR green mastermix (Qiagen, China) and run on an ABI 7500 RT-PCR system (Applied Biosystems) with the following PCR cycle conditions—1 cycle—10 min/95°C, followed by 40 cycles consisting of two steps—15 s/95°C and 1 min/60°C.
5
Quantifying Hotairm1 in Exosomes and Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time qPCR (RT-qPCR) was used to determine the levels of Hotairm1 in exosomes, Gr1+CD11b+ cells, or S100A9 immunoprecipitates. Exosomes were purified from plasma or cell culture supernatants, and exosomal RNA was isolated using exoRNeasy Starter Kit (Qiagen). Total cellular RNA was isolated from Gr1+CD11b+ cells using TRIzol reagent (Invitrogen). Levels of Hotairm1 expression were measured using QuantiTect PCR Mastermix and RT2 lncRNAqPCR Assay primers (Qiagen). The expression level was calculated using the 2−ΔΔCt cycle threshold method. Values were normalized to GAPDH RNA for total RNA or 18S RNA for exosomal RNA, amplified with QuantiTect Primer Assays. The PCR was performed in duplicate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!