Using first strand cDNA obtained from a healthy donor as templates, the full-length coding sequence of RRP7A (GenBank accession number NM_015703.4) was PCR amplified and cloned into the mammalian expression vector pEGFP-n1 using EcoRI and BamHI restriction sites. Two full-length wild-type expression constructs for RRP7A were generated; one containing a green fluorescent protein (GFP)-tag at the C-terminus and another containing a FLAG-tag at the N-terminus and a C-terminal GFP-tag, using pEGFP plasmid (Addgene). The mutation p.W155C was introduced into these vectors using QuikChange II Site-Directed Mutagenesis Kit (Agilent technologies Inc.). The primers used were 5′-GGCATTCACAAGTGCATCAGTGACTACGC-3′ (sense) and 5′-GCGTAGTCACTGATGCACTTGTGAATGCC-3′ (anti-sense). Expression constructs were verified by Sanger sequencing, and expressed in RPE-1 and HEK293T cells. Cells were seeded in DMEM without pen/strep, and transfected using FuGENE6 HD Transfection Reagent (Promega) when they reached ~60% confluence69 (link). As a control in IP analyses, HEK293T cells were also transfected with the empty vector pEGFP-C1.
Fugene6 hd transfection reagent
Manufactured by Promega
FuGENE6 HD Transfection Reagent is a non-liposomal transfection reagent used for the introduction of nucleic acids into eukaryotic cells. It is designed to efficiently deliver plasmid DNA, siRNA, and other nucleic acids into a variety of cell types.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions)
Pegfp plasmid, by Addgene (1 mentions)
Quikchange 2 site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Topo cloning, by Thermo Fisher Scientific (1 mentions)
Interferrin, by Polyplus Transfection (1 mentions)
Gateway cloning, by Thermo Fisher Scientific (1 mentions)
Q5 site directed mutagenesis kit, by New England Biolabs (1 mentions)
Quikchange xl site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Pnpp buffer, by Thermo Fisher Scientific (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
4 protocols using fugene6 hd transfection reagent
1
Generation of GFP-Tagged RRP7A Expression Constructs
2
Protease silencing and expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genes were silenced using siRNAs obtained from Qiagen targeting (all 5′ to 3′): ZDHHC5: ACCACCATTGCCAGACTACAA, PC2: AAGGTTATGGTCAATCCCAAA, Furin: 1-CCCGAGGATGACGGCAAGACA and 8-TTCCCTGTCCCTCTAAAGCAA, PC7: CAGCAAGTACGGATTCATCAA, PC7: 1-TAGCTATGACCTCAACTCTAA and 8-CAGGAGCGCATCTCAATGGAA, and viral glycoprotein VSV-G (as negative control): ATTGAACAAACGAAACAAGGA. For Furin and PC7, two different siRNAs were used because one was outside the coding sequence for recomplementation purposes. Silencing was performed for 72–96 h using Lipofectamine RNAiMAX (Thermo Fisher Scientific 13778150) or INTERFERrin (Polyplus 409-10) following the manufacturer’s protocol. Silencing efficiency was checked via Western blot and qPCR.
Plasmids were constructed using Gateway cloning (Thermo Fisher Scientific) for PC2, PC7, and E-cadherin or TOPO cloning (Thermo Fisher Scientific) for Furin. PC-sensor plasmids were a gift from the Constam laboratory, Ecole Polytechnique Federale de Lausanne, Lausanne, Switzerland. Point mutations to change or insert residues were performed using QuikChange XL site-directed mutagenesis kit (Agilent Technologies) or Q5 Site-directed mutagenesis kit (New England Biolabs). Proteins were expressed in RPE-1 cells for 24–48 h using FuGENE 6 HD Transfection Reagent (Promega E2691) following the manufacturer’s protocol.
Plasmids were constructed using Gateway cloning (Thermo Fisher Scientific) for PC2, PC7, and E-cadherin or TOPO cloning (Thermo Fisher Scientific) for Furin. PC-sensor plasmids were a gift from the Constam laboratory, Ecole Polytechnique Federale de Lausanne, Lausanne, Switzerland. Point mutations to change or insert residues were performed using QuikChange XL site-directed mutagenesis kit (Agilent Technologies) or Q5 Site-directed mutagenesis kit (New England Biolabs). Proteins were expressed in RPE-1 cells for 24–48 h using FuGENE 6 HD Transfection Reagent (Promega E2691) following the manufacturer’s protocol.
3
Quantifying Rhomboid-Mediated Cleavage
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To test rhomboid cleavage of candidate substrate transmembrane domains, 5 × 104 HEK293 cells were plated in one well of a 96 well plate in the presence of 30 ng each of plasmids encoding AP-TMD and 3xHA-RHBDL constructs, pre-complexed in optiMEM (GIBCO) with FuGene6 HD transfection reagent (Promega), according to manufacturers instructions. Cells were left for 24 hours to attach and express protein, and then exchanged into 200 μl optiMEM overnight. AP activity was detected in the supernatants or in cell lysates (using Triton X-100 buffer) by adding equal volumes of PNPP buffer (Thermo Scientific) followed by measurement of absorbance at 405 nm on a plate reader. The percentage of the total material shed from each well (i.e., signal from supernatant divided by total signal from lysate and supernatant) was then used to calculate release, and processed as described in the figure legends. Error bars represent SEM.
4
CRISPR-mediated Allele Targeting in Prostate Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The MIT CRISPR tool (http://crispr.mit.edu/ ) was used to design guide RNA to 47bp and 21bp alleles (Supplementary Table 8). Guide RNA specific to 47bp or 21bp alleles were cloned into the doxycycline-inducible guide RNA vector Fgh1UTG (kindly provided by Dr Marco Herold Lab). LNCaP and DUCaP cells were infected with lentiviral Cas9 (pCas9Cherry, kindly provided by Dr Marco Herold and guide RNA cloned Fgh1UTG vector. To produce lentiviral particles, HEK293T cells were transiently transfected with vector DNA, along with the packaging plasmids pMDL, pRSV-rev and pVSVG, and the target plasmid (pCas9, Fgh1UTG) using Fugene6 HD transfection reagent (Promega) according to the manufacturer’s guidelines. Virus-containing supernatants were collected after 48 h and LNCaP and DuCaP cells were infected with the viral suspension in the presence of polybrene (8 μg/mL). After 24 h, viral transduced cells were sorted for cells positive for mCherry (pCas9) and EGFP (Fgh1UTG) to produce double-positive cells. The disruption or substitution of the allele sequences were then confirmed by Sanger Sequencing (AGRF).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!