Abi prism 7300 sequence detection

TRIzol reagent ordered from Invitrogen was responsible for cell total RNA extraction, after which reverse transcription into cDNA was carried out with the use of a PrimeScript RT Master Mix purchased from Takara, Japan. Using this cDNA as a template, PCR was performed on ABI PRISM 7300 sequence detection system (Applied Biosystems Inc.) as instructed by the SYBR Premix Ex Taq II kit manuals (Takara). Specific primers used in qRT-PCR, which were presented as below, were synthesized by Shanghai Sangon Biotech: miR-137: sense (5′-3′): CGCGTAGTCGAGGAGAGTACCA; antisense (5′-3′): AGTGCAGGGTCCGAGGTATT; U6: sense: CTCGCTTCGGCAGCACA; antisense: AACGCTTCACGAATTTGCGT; AMPK: sense: TTTGCGTGTACGAAGGAAGAAT; antisense: CTCTGTGGAGTAGCAGTCCCT; β-actin: sense: CCTGGCACCCAGCACAAT; and antisense: GGGCCGGACTCGTCATAC. 2^−ΔΔCt was used to calculate miR-137 and AMPK expression relative to U6 and β-actin, respectively. Mean values were obtained after three repeated measurements.

The total RNA extraction was carried out following the descriptions given by Muthaiyan et al. [37 (link)] and Zhang et al. [36 (link)] with slight modifications. Based on the MIC determination results, 1/2 MIC concentration and MIC concentration of GEO were added to the log-phase bacteria and then treated bacteria were cultured for 30 min at 37 °C. The control group without GEO was also incubated for 30 min. Subsequently, all the bacterial samples were centrifuged at 10,000× g for 3 min to collect the bacterial pellets followed by washing with PBS. According to the manufacturer’s instructions, total RNA was extracted using 1 mL RNA Isolater Total RNA Extraction reagent (Nanjing Vazyme Biotech Co., Ltd., Nanjing, China.). The purity of RNA was determined by A₂₆₀/A₂₈₀. Reverse transcription was performed using a Vazyme reverse transcription kit. The cDNA was preserved at −80 °C. The LightCycler 480 SYBR Green I Master kit (Shanghai Bestway Enterprise Co., Ltd., Shanghai, China.) was used for quantitative fluorescence PCR detection. RT-PCR was performed using ABI PRISM 7300 Sequence Detection (Applied Biosystems, Carlsbad, CA, USA). The expression of bacterial lysis related genes (Table S1) was analyzed by using the 2^−ΔΔCt method. 16S rRNA gene was used as an internal control gene. Each sample was tested with at least three independent readings to ensure the data reproducibility.