Once the positive clones were detected, BAC-DNA was extracted and purified to be sequenced and used as a cytogenetic probe, using the Large Construct and Plasmid Mini kits’ protocol from Qiagen (Hilden, Germany), respectively. Once extracted, clones were quantified by spectrophotometry using the NanoDrop™ 2000/2000c (Thermo Scientific™, Waltham, MA, USA). In addition, the BAC clone was verified by PCR using the protocol previously described.
Plasmid mini
Manufactured by Qiagen
Sourced in United States
The Plasmid Mini is a laboratory equipment product designed for the purification of plasmid DNA from bacterial cultures. It is a compact and efficient tool that allows for the isolation of high-quality plasmid DNA in a small-scale setting.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using plasmid mini
1
BAC Clone Extraction and Validation
2
Bacterial DNA and Plasmid Extraction
3
Cloning and Expression of Insect Odorant Receptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A cDNA clone of DmOR85b was a kind gift from Charles W. Luejche's lab. The sequences for the DmORCO (accession Q9VNB5) and DmOR67a (accession Q9VT08) genes were obtained from Pubmed, optimized for E. coli expression, and synthesized by Gen9 Inc, Cambridge, MA, USA. For each OR, a C-terminal 1D4 tag was added for detection and purification, as well as a 3′ NcoI site and a 5′ XhoI site for cloning. The restriction sites and 1D4 tag were either synthesized directly (DmOR67a and DmORCO), or added using PCR (DmOR85b) (Forward: TATATAGAATTCGAGGAGGGCCACCATGGAGAAGCTAATGAAGTACGC; Reverse: TATATACTCGAGTTATTAAGCTGGCGCCACCTGGGAAGTCTCGGTGCCGGAGGAGCCTTGGGTATACATTGTGCGC). All OR DNA sequences were cloned into the pIVex2.3d vector using the restriction sites and transformed into chemically competent DH5α cells (Invitrogen, Life Technologies, Grand Island, NY, USA). The plasmids were amplified and extracted (Qiagen Plasmid Mini or Maxi kits; Qiagen, Germantown, MD, USA), and the sequences were verified using plasmid specific primers (Forward: CGACTCACTATAGGGAGACC; Reverse: TAGTAACGGCCGCCAGTGTGCTG).
4
Cloning and Sequencing of hsv1-miR-H27
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The qPCR product for hsv1-miR-H27 was first subjected to agarose gel electrophoresis and the band complementary to the size of cDNA was excised and purified using NucleoSpin® Gel and PCR Clean-up (Macherey-Nagel, Germany).
The purified product was cloned into T&A™ cloning vector by using T&A™ Cloning Vector (Yeastern Biotech Co., Ltd, Taiwan) and followed by a transformation into Escherichia coli E. cloni® 10G strain. Positive transformants were selected using a blue-white screening method. White colonies were picked for colony PCR to further confirm positive transformants. The recombinant plasmid was extracted from the positive transformant using Qiagen® Plasmid Mini (Qiagen, USA) and sequenced (Advanced Innovative Trusted Products & Solutions, AITbiotech Pte.
Ltd., Singapore).
The purified product was cloned into T&A™ cloning vector by using T&A™ Cloning Vector (Yeastern Biotech Co., Ltd, Taiwan) and followed by a transformation into Escherichia coli E. cloni® 10G strain. Positive transformants were selected using a blue-white screening method. White colonies were picked for colony PCR to further confirm positive transformants. The recombinant plasmid was extracted from the positive transformant using Qiagen® Plasmid Mini (Qiagen, USA) and sequenced (Advanced Innovative Trusted Products & Solutions, AITbiotech Pte.
Ltd., Singapore).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!