Ubc creert2 transgenic mice

Filip1l-floxed mice were generated as described previously (18 (link)). Filip1l^fl/fl mice were subsequently generated and were crossed with Ubc-CreER^T2 transgenic mice (Jackson laboratories #007001, RRID:IMSR_JAX:007001) to generate inducible systemic Filip1l^fl/fl; Ubc-CreER^T2 knockout mice. To induce Cre recombinase-mediated knockout of Filip1l gene, tamoxifen (TAM; 160 mg/kg/day) was injected intraperitoneally for 5 consecutive days. Lungs were fixed in 10% neutral buffered formalin and subject to IHC analysis. Three 10-μm-thick sections were cut from each formalin-fixed paraffin-embedded (FFPE)-lung tissue block, and genomic DNAs and total RNAs were purified using AllPrep DNA/RNA FFPE Kit (Qiagen #80234). The combined Filip1l allele was detected using primers, ACATGCGTAATGGCTCAAGCAAGC and GGAGAATGTCCAGAAGTTTATGTC. The housekeeping gene, m18S RNA was detected using primers, CTTAGAGGGACAAGTGGCG and ACGCTGAGCCAGTCAGTGTA.

Mice were maintained on 12 h light : dark cycles at a temperature of 22 °C with a humidity of 55%, and fed a standard diet. Meg^lox/lox and Nph2^lox/lox mice were crossed with tamoxifen‐inducible UBC‐cre/ERT2 transgenic mice (The Jackson Laboratory, Bar Harbor, ME, USA) [27 (link)]. Tail DNA was analyzed by PCR for genotyping. All mice were of a mixed C57BL/6‐129/Svj background. At age 8 to 12 weeks, female inducible megalin knock out (KO) (Meg^lox/lox; Cre⁺), podocin KO (Nph2^lox/lox; Cre⁺) and littermate control mice (Meg^lox/lox, Nph2^lox/lox; Cre⁻), were induced by i.p. injection of tamoxifen (Cat.No.: T5648, Sigma‐Aldrich) at a dose of 50 mg·kg⁻¹ body weight for 5 consecutive days. The knockdown of the target genes in the kidney was assessed by quantitative real‐time PCR at termination, 4 weeks after the first day of tamoxifen induction. Mice with less than 70% megalin or podocin gene knock out were excluded. Mouse breeding and experiments were carried out in a certified animal facility according to provisions from the Danish Animal Experiments Inspectorate (2020‐15‐0201‐00400). Urine was collected at week 3 by housing the mice in metabolic cages for 24 h, and the urinary protein excretion was estimated by urine dipstick test (Roche Combur‐Test).