The largest database of trusted experimental protocols

3 protocols using scai digestion

1

Dual-Insert Plasmid for Fluorescent Dye Calibration

Check if the same lab product or an alternative is used in the 5 most similar protocols
In order to verify whether the two fluorescent dyes present different intensities of fluorescence emission and to normalize for differences between runs (master mix performance, instrument calibration, environmental variability, etc.) a plasmid construct was designed. A portion of mt-tRNALeu and B2M genes were amplified using the previously reported primers. Two sequential TA cloning reactions were performed to insert the two targets into the pGEM-T vector (Promega Co., Madison, WI, USA). The successful cloning of the two target sequences in a 1:1 ratio was verified by sequencing and PCR. The distance between both inserts was chosen to be greater than 500 bp to avoid the amplification of both targets as one amplicon in the qPCR reaction (Fig. 1).

Scheme of the linearized dual insert plasmid (pGEM-T vector, 3194 bp) showing the inserts of human mtDNA and nuclear DNA.

Plasmids were extracted from NEB Turbo Competent E. coli (New England Biolabs, Ipswich, MA, USA) with PureYield Plasmid Midiprep kit (Promega Co., Madison, WI, USA) and the concentration was measured using Qubit fluorometer (Thermo Fisher Scientific, Waltham, MA, USA). The plasmid was linearized by ScaI digestion (New England Biolabs, Ipswich, MA, USA) and the linearized plasmid was used as calibrator in all the qPCR experiments.
+ Open protocol
+ Expand
2

Generating TALEN mRNA for Ferret Genome Editing

Check if the same lab product or an alternative is used in the 5 most similar protocols
We assembled three pairs of transcription activator-like effector
nucleases (TALENs) that target exon 15 of ferret Aspm, which
encodes the second CH domain, and cloned into a mammalian expression vector with
the CMV and T7 promoters through a commercial service (PNA Bio). Gene targeting
efficiency of each TALEN pair was tested in HEK 293T cells using a split
GFP-based reporter30 (link). The most
efficient pair, targeting
TGAGAGCATAAAGCTGTTGATGGAGTGGGTAAATGCTGTTTGTGCTTTCTATA(target-spacer-target) was
chosen for genome editing in vivo. These plasmids are available
through Addgene.org. For mRNA synthesis, endotoxin-free TALEN plasmids were
prepared using NucleoBond Xtra Midi EF kit (Clontech), ethanol-precipated 3
times, linearized with ScaI digestion (New England BioLabs), and gel purified.
mRNAs were synthesized using mMessage mMachine T7 ULTRA kit (ThermoFisher
Scientific), cleared by MEGAclear transcription clean-up kit (ThermoFisher
Scientific). Of note, we performed the optional ammonium acetate precipitation
to improve the quality of the mRNAs. The TALEN mRNAs were diluted in sterile
EmbryoMax injection buffer (Millipore) at 50 ng/μl, aliquoted, and kept
frozen at −150 °C until used.
+ Open protocol
+ Expand
3

Generating TALEN mRNA for Ferret Genome Editing

Check if the same lab product or an alternative is used in the 5 most similar protocols
We assembled three pairs of transcription activator-like effector
nucleases (TALENs) that target exon 15 of ferret Aspm, which
encodes the second CH domain, and cloned into a mammalian expression vector with
the CMV and T7 promoters through a commercial service (PNA Bio). Gene targeting
efficiency of each TALEN pair was tested in HEK 293T cells using a split
GFP-based reporter30 (link). The most
efficient pair, targeting
TGAGAGCATAAAGCTGTTGATGGAGTGGGTAAATGCTGTTTGTGCTTTCTATA(target-spacer-target) was
chosen for genome editing in vivo. These plasmids are available
through Addgene.org. For mRNA synthesis, endotoxin-free TALEN plasmids were
prepared using NucleoBond Xtra Midi EF kit (Clontech), ethanol-precipated 3
times, linearized with ScaI digestion (New England BioLabs), and gel purified.
mRNAs were synthesized using mMessage mMachine T7 ULTRA kit (ThermoFisher
Scientific), cleared by MEGAclear transcription clean-up kit (ThermoFisher
Scientific). Of note, we performed the optional ammonium acetate precipitation
to improve the quality of the mRNAs. The TALEN mRNAs were diluted in sterile
EmbryoMax injection buffer (Millipore) at 50 ng/μl, aliquoted, and kept
frozen at −150 °C until used.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!