Control mimic

Manufactured by Qiagen

Sourced in United States

Control mimic is a laboratory tool designed to serve as a reference sample for analytical procedures. It can be used to validate the performance of various assays and instruments. The control mimic is formulated to closely resemble the target analyte, enabling accurate assessment of the analytical process.

Automatically generated - may contain errors

Lab products found in correlation

Red siglo oligos, by Thermo Fisher Scientific (2 mentions) Lipofectaine 2000 reagent, by Thermo Fisher Scientific (2 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions) Hmgb1, by R&D Systems (1 mentions) Hsp70, by StressMarq Biosciences (1 mentions) Dual light luciferase β galactosidase reporter gene assay system, by Thermo Fisher Scientific (1 mentions) 96 well plate, by Celltreat (1 mentions) Mirna mimic, by Qiagen (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Passive lysis buffer (plb), by Promega (1 mentions) Dual luciferase reporter assay system, by Promega (1 mentions) Q5 site directed mutagenesis kit, by New England Biolabs (1 mentions) Infinite 200 plate reader, by Tecan (1 mentions)

Close spelling variants of this product

Control miRNA mimics

8 protocols using control mimic

Transient Transfection of Viral miRNA Mimics

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transient transfections were performed using Lipofectaine 2000 reagent (Life Technologies, San Diego, CA, USA) according to manufacturer’s instructions. Red siGLO oligos (Thermo Fisher Scientific, Waltham, MA, USA) were used to determine transfection efficiency. After 36 h, cells were harvested for protein detection or RNA isolation. Cells were transfected with viral miRNA mimics (Qiagen, Gaithsburg, MD, USA) at a final concentration of 15 nM for 36 h. Controls consisted of mock transfected and control mimic (Qiagen) transfected cultures. Levels of viral miRNAs were used to determine transfection efficiency using miScript PCR primer assays as described above.

Naqvi A.R., Shango J., Seal A., Shukla D, & Nares S. (2018). Viral miRNAs Alter Host Cell miRNA Profiles and Modulate Innate Immune Responses. Frontiers in Immunology, 9, 433.

+ Open protocol

+ Expand

HUVEC Transfection and Plasma Treatment

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human umbilical vein endothelial cells (HUVECs) (ATCC-CRL-1730) were cultured in F-12K medium (ATCC-100-010) with 10% FBS (ATCC-30-2020) according to the instructions provided by ATCC.
HUVECs were transfected with 1 mg of luciferase reporter constructs, and either 20 nmoles of either 328a-3p microRNA mimic (Qiagen, Hilden, Germany, cat # 219600-MSY0000752-5 ‘CUGGCCCUCUCUGCCCUUCCGU), control mimic (Qiagen cat # 339173 -YM00479902), inhibitor (Qiagen, cat# 339121 (YI04101608), 5 ‘CUGGCCCUCUCUGCCCUUCCGU) or control inhibitor (Qiagen cat# 339125-YI00199006) using FuGENE 6 reagent according to the manufacturer’s instructions (Roche, Indianapolis, IN, USA). The media was changed after 1–2 h to serum-free media and the cells were harvested 24 h post-transfection.
Fetal bovine serum (FBS)–starved HUVECs (for 24 h) in 1 mL of medium were treated for 24 h with either 25, 50, or 100 μL of pooled human plasma from normal controls, patients with either CAD or ectasia. In separate experiments, FBS-starved HUVECs were also treated with endotoxin-free (according to the manufacturer) human recombinant HSP70 (0.5 ng/mL, StressMarq Biosciences, Victoria, BC, Australia), S100B (0.1 ng/mL) or HMGB1 (10 ng/mL, R&D Systems, Minneapolis, MN, USA).

Tsoporis J.N., Triantafyllis A.S., Kalogeropoulos A.S., Izhar S., Rigopoulos A.G., Rallidis L.S., Sakadakis E., Toumpoulis I.K., Salpeas V., Leong-Poi H., Parker T.G, & Rizos I. (2023). Differential Expression of Circulating Damage-Associated Molecular Patterns in Patients with Coronary Artery Ectasia. Biomolecules, 14(1), 10.

+ Open protocol

+ Expand

Viral miRNA Transfection Optimization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transient transfections were performed using Lipofectaine 2000 reagent (Life Technologies, San Diego, CA) according to manufacturer’s instructions. Red siGLO oligos (ThermoScientific, Waltham, MA) were used to determine transfection efficiency. After 36 hours, cells were harvested for RNA isolation. Cells were transfected with viral miRNA mimics at increasing concentrations of 10, 20 and 50 nM (to determine dose effects) for 36 hours. We noticed robust (~90%) transfection at 20 nM, therefore, we used the same concentration for most of the experiments unless specified. Controls consisted of mock transfected and control mimic (Qiagen) transfected cultures.

Naqvi A.R., Seal A., Shango J., Navarette M.B., Martinez G., Chapa G., Hasan S., Yadavalli T., Jaishankar D., Shukla D, & Nares S. (2018). Herpesvirus-encoded microRNAs detected in human gingiva alter host cell transcriptome and regulate viral infection. Biochimica et biophysica acta, 1861(5), 497-508.

+ Open protocol

+ Expand

miRNA-Mediated Luciferase Reporter Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

B35 neuroblastoma cells were plated in a 96-well plate (Celltreat Scientific Products) at a concentration of 2.0×10⁵ cells/ml and allowed to adhere overnight. The next day, cells were co-transfected with the appropriate Luciferase 3′ UTR reporter plasmid, β-Galactosidase control, and 100 nM of miR-200a, miR-200b or control mimic (Qiagen) per well using Lipofectamine 3000 (Invitrogen). After 48 h, luciferase activity was determined using Dual Light Luciferase & β-Galactosidase Reporter Gene Assay System (ThermoFisher Scientific) according to the manufacturer's protocol.

Walker S.E., Sabin K.Z., Gearhart M.D., Yamamoto K, & Echeverri K. (2022). Regulation of stem cell identity by miR-200a during spinal cord regeneration. Development (Cambridge, England), 149(3), dev200033.

+ Open protocol

+ Expand

Transient Transfection of miRNA Mimics

Check if the same lab product or an alternative is used in the 5 most similar protocols

For transient transfection, cells at 50% confluence were transfected with miRNA mimics or control mimics (Qiagen) using Lipofectamine3000 (Invitrogen) according to the manufacturer's instructions.

Zhu J., Wang S., Zhang W., Qiu J., Shan Y., Yang D, & Shen B. (2015). Screening key microRNAs for castration-resistant prostate cancer based on miRNA/mRNA functional synergistic network. Oncotarget, 6(41), 43819-43830.

+ Open protocol

+ Expand

Optimization of miR-30c Modulation in Bovine Embryo Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

Since individually cultured embryos have less tolerance when compared to group cultured embryos (Goovaerts et al., 2009 (link); Wydooghe et al., 2014a (link),b (link)) and they easily die after changing the culture environment, group culture was performed for miR-30c functional analysis instead of individual culture. The IVF embryos were produced according to the previously described protocol. This time, however, presumed zygotes were vortexed for 3 min after 21 h incubation, washed with IVF-TALP and transferred to drops of SOF supplemented with ITS, BSA and miR-30c mimics (chemically synthesized, double-stranded RNAs which mimic mature endogenous miRNAs after delivery to cells) or control mimics (chemically synthesized, double-stranded RNAs which have no homology to any known microRNA or mRNA sequences) (Qiagen, Germantown, United States) with a final concentration of 1 μM according to the instructions. Culture occurred in groups of 25 in drops of 50 μl, covered with mineral oil at 38.5°C in 5% CO₂, 5% O₂, and 90% N₂. On 8 dpi, blastocyst rates were calculated. Blastocysts were collected for RT-qPCR or assessed with apoptosis staining.

Lin X., Beckers E., Mc Cafferty S., Gansemans Y., Joanna Szymańska K., Chaitanya Pavani K., Catani J.P., Van Nieuwerburgh F., Deforce D., De Sutter P., Van Soom A, & Peelman L. (2019). Bovine Embryo-Secreted microRNA-30c Is a Potential Non-invasive Biomarker for Hampered Preimplantation Developmental Competence. Frontiers in Genetics, 10, 315.

+ Open protocol

+ Expand

Dual Luciferase Assay for miRNA Targets

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Dual luciferase experiments were performed as previously described (16 (link), 17 (link), 30 (link), 32 (link)). In brief, HEK293 cells were seeded at the density of 3×10⁴ cells/well (96-well plate) in DMEM supplemented with 10% fetal bovine serum. All transfections were performed in quadruplicate using 0.5 μL Lipofectamine 2000 (Invitrogen), 120 ng dual luciferase reporter control (CmiT000001-MT06 miRNA Target clone control vector for pEZX-MT06) or plasmids containing human VCL (NM_003373.3; HmiT018467-MT06), human DAB2 (NM_001244871.1; HmiT055467-MT06) or human SKAP2 (NM_001303468.1; HmiT067400-MT06; All from GeneCopoeia Incorporated, Rockville, MD, USA) were co-transfected with a final concentration of 1 pmol, 5 pmol and 10 pmol of synthetic miR-142–3p or control mimics (10 pmol) (Qiagen). After 36 h post-transfection, cells were lysed in passive lysis buffer (Promega Corporation) and dual luciferase assays performed using the multilabel reader Victor™ x5 (PerkinElmer 2030-Perkin Elmer Health Sciences Inc, Shelton, CT, USA). For each reporter 3′UTR construct, the Rluc/Fluc value obtained was normalized to the value obtained for pEZX-MT06 no-insert control (EV) co-transfected with the same miRNA mimic. The values obtained were plotted as histograms, where EV is set at one.

Valverde A., Nares S, & Naqvi A.R. (2020). Impaired cell migration and structural defects in myeloid cells overexpressing miR-30b and miR-142–3p. Biochimica et biophysica acta. Gene regulatory mechanisms, 1863(11), 194628.

+ Open protocol

+ Expand

Vezf1 3'UTR Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

A 400-base pair segment of the 3′UTR of Vezf1 containing the binding site for miR-150-5p was cloned into the pIS0 Firefly luciferase reporter (Addgene) using NheI and SacI restriction sites. The DNA fragment was amplified from mouse genomic DNA using the following primers: Forward 5′-GGGGAGCTCACAGAGTCAAAATTGGG-3′ and Reverse 5′-GGGGCTAGCGGTTCCGTCCACCTTGT-3′. HeLa cells were transfected with the pIS0 3′UTR Vezf1 reporter or a reporter mutated at the putative miR-150-5p-binding site in the Vezf1 3′UTR using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs) along with the pIS2 Renilla vector (Addgene). HeLa cells were also cotransfected with 50 nM miR-150-5p miRCURY LNA™ mimics or control mimics (Qiagen). Dual-luciferase assays were performed using the Dual-Luciferase® Reporter Assay System (Promega Corporation) and luciferase activity was measured using the Infinite® 200 plate reader (Tecan).

Perales G., Westenskow M., Gutierrez R., Caldwell K.K., Allan A.M, & Gardiner A.S. (2022). MicroRNA-150-5p is upregulated in the brain microvasculature during prenatal alcohol exposure and inhibits the angiogenic factor Vezf1. Alcoholism, clinical and experimental research, 46(11), 1953-1966.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!