Total DNA from soil samples was extracted by commercial kit FASTDNA SPIN KIT for soil (Qbiogene, Carlsbad, USA) according to the manufacturer's procedure. PCR amplification was performed in a final volume of 50 μL using primers 907R and 357F, adding a GC-clamp to the forward primer [14 (link), 15 (link)]. The reaction mixture was prepared with 1X PCR buffer, 2.5 mM MgCl2, 0.12 mM deoxynucleoside triphosphate, 0.3 mM of each primer and 1U Taq DNA polymerase and 10 ng of pooled DNA obtained from the three plant replicates were added as template. PCR products were resolved on 7% (w/v) polyacrylamide gel in 1X TAE pH 7.4 with a 40–60% denaturing gradient. Gels were run at 90 V for 17 h at 60°C in DCode apparatus (Bio-Rad, Italy). After electrophoresis, gels were stained with ethidium bromide solution for 30 min, washed with sterile distilled water, and photographed on a UV transillumination table. The DGGE band profiles were converted into numerical values using Image J (version 1.46) and XLSTAT software.
Dcode apparatus
Manufactured by Bio-Rad
Sourced in United States
The DCode apparatus is a lab equipment used for DNA fragment separation and analysis by denaturing gradient gel electrophoresis (DGGE). It provides a consistent and controlled environment for DNA sample migration and visualization.
Automatically generated - may contain errors
7 protocols using dcode apparatus
1
DGGE Analysis of Soil Microbial Community
2
Denaturing Gradient Gel Electrophoresis for Bacterial Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The denaturing gradient gel electrophoresis (DGGE) scheme was performed by using a DCode apparatus (Bio-Rad, Richmond, CA, USA) at 60°C and employing 8% polyacrylamide gel with a denaturing range of 30% – 55% for the total bacteria, 30% – 50% for the Lactobacillus, and 45% – 55% for the Bifidobacterium. Gel electrophoresis of the total bacteria, Lactobacillus, and Bifidobacterium was run at 20V for 10 minutes, and again at 70V for 18 hours, 70V for 16 hour, and 85V for 16 hour, respectively (16 (link)-18 (link)). The gels were visualized under UV light after staining them with gene finder (0.5 μg mL-1) and taking photographs.
3
Bacterial Diversity Analysis via DGGE
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Denaturing gradient gel electrophoresis (DGGE) was performed using a DCode apparatus (Bio‐Rad, Richmond, CA) at 60°C and employing 8% polyacrylamide gels with a denaturing range of 40–60% for total bacteria. Electrophoresis was performed at 75 V for 16 h and 130 V for 4.5 h for bacteria. Bands were visualized under UV light after staining with ethidium bromide (0.5 mg mL−1) and photographed.
Bands in the gels were identified by sequencing. Bands were excised from the gels and set to sequence (Sangon Biotech, Shanghai, China). The identity of the sequences was determined by the BLASTN algorithm in the GenBank database (http://www.ncbi.nlm.nih.gov/BLAST/ ).
Bands in the gels were identified by sequencing. Bands were excised from the gels and set to sequence (Sangon Biotech, Shanghai, China). The identity of the sequences was determined by the BLASTN algorithm in the GenBank database (
4
Detection and Identification of Tetracycline Resistance Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA from cheeses and strains harbouring known tet genes (Lactococcus lactis IPLA 31008 [tet(M)], Enterococcus faecalis Jtet [tet(O)], Enterococcus spp. ET15 [tet(S)], and Bifidobacterium longum B93 [tet(W)]) was amplified by PCR using DGGE primers (Table 1 ), employing the PCR conditions described elsewhere [15 (link)]. DGGE analysis of the amplified tet genes was performed as previously reported [16 (link)] with slight modifications. Briefly, DGGE was performed in a DCode apparatus (Bio-Rad, Richmond, CA, USA) at 60°C on 8% polyacrylamide gels with a formamide-urea denaturing gradient of 15–50%. Electrophoresis was conducted at 150 V for 2 h and 200 V for 1 h. After electrophoresis, gels were stained in an ethidium bromide solution (0.5 μg mL−1), and the DNA bands were visualized and captured using a Gbox system and GeneSys software (Syngene, Cambridge, UK). After isolation and reamplification with the same primers without the GC clamp and identical PCR conditions, bands from the acrylamide gels were identified by sequencing and sequence comparison. Online similarity searches were performed by using the BLAST tool in the GenBank database (http://www.ncbi.nlm.nih.gov/BLAST/ ).
5
DGGE Analysis of PCR Products
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR products were analyzed by DGGE using a Bio-Rad D-code apparatus. Samples were applied to 8% (wt/vol) polyacrylamide gels in 0.5×Tris base-acetic acid buffer. Parallel electrophoresis experiments were performed at 60°C by using gels containing a 30% to 60% urea-formamide denaturing gradient (100% corresponded to 7 M urea and 40% (wt/vol) formamide). The gels ran for 16 h at 75 V, then were stained with ethidium bromide for 5 min, rinsed for 15 min in distilled water, observed and photographed by the Bio-Rad Gel Doc system (BioRad, Milano, Italy).
6
DGGE Analysis of 16S rRNA Gene Amplicons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples of 200-bp PCR products (using V3 primer sets) were analyzed in 8% (wt/vol) polyacrylamide gels in 1× TAE buffer, whereas those of 400 bp (using V4V5 and V6V8 primer sets) were run in 6.5% (wt/vol) polyacrylamide gels (Ercolini et al., 2003) (link). Parallel electrophoresis was performed at 20 V for 10 min followed by 16 h at 50 V by using a Bio-Rad Dcode apparatus (Universal Mutation Detection System, Bio-Rad Laboratories). The gel contained 20 to 80% urea formamide, for which 100% denaturant solutions consisted of 40% (vol/vol) formamide and 7 M urea. All DGGE reagents were from Severn Biotech Ltd. (Worcestershire, UK). The gel was stained with GelStar (Lonza, Rockland, ME) and the images recorded.
7
Bacterial 16S rRNA Gene Amplification and DGGE
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Purified total and genomic DNA was used as a template for the amplification of the V3 region of the bacterial 16S rRNA gene by PCR using two universal primers: 357F
(5' CCTACGGGAGGCAGCAG 3') and 518R (5' GTATTACCGCGGCTGCTGG 3').
A GC clamp of 40 nucleotides (CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG) was attached to the 5ʼ end of the forward primer (357F-GC), as described by Muyzer et al. (1993) . The PCR reaction mixtures contained 3 µl of total DNA, 25 µl of Taq Master Mix (Ampliqon), 1 µl of each of the primers (10 µM) and 20 µl of H 2 O in a total volume of 50 µl. The PCR amplification conditions were as follow: an initial cycle at 95ºC for 5 min, 30 cycles at 95ºC for 30 s, 56ºC for 30 s, 72ºC for 1 min, and a final extension step at 72ºC for 10 min. DGGE was performed in a DCode apparatus (Bio-Rad) using 8% polyacrylamide gels with denaturing ranges of 40-60%. Electrophoresis ran at 60ºC and 75 V for 17 h.
The resulting gels were stained in an ethidium bromide solution (0.5 µg ml -1 ) for 15 min, rinsed with water, and photographed under UV light using a G-Box system (Syngene).
(5' CCTACGGGAGGCAGCAG 3') and 518R (5' GTATTACCGCGGCTGCTGG 3').
A GC clamp of 40 nucleotides (CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG) was attached to the 5ʼ end of the forward primer (357F-GC), as described by Muyzer et al. (1993) . The PCR reaction mixtures contained 3 µl of total DNA, 25 µl of Taq Master Mix (Ampliqon), 1 µl of each of the primers (10 µM) and 20 µl of H 2 O in a total volume of 50 µl. The PCR amplification conditions were as follow: an initial cycle at 95ºC for 5 min, 30 cycles at 95ºC for 30 s, 56ºC for 30 s, 72ºC for 1 min, and a final extension step at 72ºC for 10 min. DGGE was performed in a DCode apparatus (Bio-Rad) using 8% polyacrylamide gels with denaturing ranges of 40-60%. Electrophoresis ran at 60ºC and 75 V for 17 h.
The resulting gels were stained in an ethidium bromide solution (0.5 µg ml -1 ) for 15 min, rinsed with water, and photographed under UV light using a G-Box system (Syngene).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!