Putative enhancers were removed using CRISPR pairs. gRNA sequences were designed with chopchop (https://chopchop.cbu.uib.no ) and corresponding DNA oligonucleotides containing BsmBI overhangs were annealed and ligated with lentiCRISPR v2 plasmid (Addgene, # 52961), which contains both Cas9 and sgRNA sequences95 (link). The sequences targeting putative enhancers are listed in Suppl. Table 1 . HEK293T17 cells (ATCC, # CRL11268) were transfected with specific lentiCRISPR v2 plasmids, as well as pMD2.G (Addgene, # 12259) and psPAX2 (Addgene, # 12260) plasmids using Fugene 6 Transfection Reagent (Promega, #E2311). 72 h after transfection, the supernatant was collected and filtered through a 0.45 μm filter (Sarstedt, # 83.1826) and virus was collected with LentiX Concentrator (Takara, # 631232). HUVEC were infected with combinations of two viruses and used 96 h after infection. Enhancer removal was confirmed by PCR, using Phusion High-Fidelity DNA Polymerase (New England Biolabs, # M0530), 1 M betaine (Sigma Aldrich, # B0300) and the primers listed in Suppl. Table 1 . PCR products were visualized on ethidium bromide agarose gels.
Lenticrispr v2 plasmid
Manufactured by Addgene
Sourced in United States
The LentiCRISPR v2 plasmid is a tool used for CRISPR-Cas9 gene editing. It contains the Cas9 endonuclease and a single-guide RNA (sgRNA) expression cassette, allowing for the delivery and expression of CRISPR components in target cells.
Automatically generated - may contain errors
Lab products found in correlation
Pspax2, by Addgene (20 mentions)
Pmd2 g, by Addgene (17 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (13 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (8 mentions)
Puromycin, by Merck Group (8 mentions)
Pcmv vsv g, by Addgene (4 mentions)
Pmd2 g and pspax2, by Addgene (3 mentions)
Puromycin, by InvivoGen (3 mentions)
Lenticrispr plasmid, by Addgene (3 mentions)
Kod plus mutagenesis kit, by Toyobo (3 mentions)
Px458 plasmid, by Addgene (3 mentions)
Lenticrispr v2 plasmid, by Thermo Fisher Scientific (3 mentions)
Fugene 6 transfection reagent, by Promega (2 mentions)
Lenti x concentrator, by Takara Bio (2 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions)
Quick ligation kit, by New England Biolabs (2 mentions)
Puromycin, by Yeasen (2 mentions)
Puromycin, by Thermo Fisher Scientific (2 mentions)
Pspax, by Addgene (2 mentions)
Pgl3 luciferase backbone, by Promega (2 mentions)
170 protocols using lenticrispr v2 plasmid
1
Enhancer Removal with CRISPR-Cas9
2
CRISPR Targeting of AAVS1, AR, and FOXA1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Twenty sgRNAs targeting the AAVS1 locus, nine sgRNAs targeting the AR gene, and six sgRNAs targeting the FOXA1 gene were designed and selected according to our prediction of sgRNA efficient scores. The sgRNA oligos were cloned into lentiCRISPRv2 plasmid (Addgene) as previously described (Shalem et al. 2014 (link)). Each plasmid containing inserted sgRNA sequence was verified using Sanger sequencing. To make lentivirus, the constructed lentiCRISPRv2 plasmids were cotransfected into 293T cells with packaging plasmids pMD2.G and psPAX2 (Addgene) using X-tremeGENE HP DNA Transfection Reagent (Roche) in 12-well plates according to the manufacturer's instructions. These 35 types of packaged lentivirus were then transduced into 293T and LNCaP-abl cells using 24-well plates, followed by puromycin selection for 3 d. The surviving cells were maintained for another 3 d before isolation of the DNA and proteins.
3
CRISPR-Cas9 Knockout of Grk2 in Flp-In-3T3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Flp‐In‐3T3 Grk2−/− cells were generated by CRISPR‐Cas9 gene editing technology as previously described 46 . Briefly, guide RNA sequences targeting Grk2 (guide‐1: 5′‐AAT GCT ACG GAG CAT GTC C‐3′; guide‐2: 5′‐CTG GAA CAC GTC CCC TCG G‐3′; guide‐3: 5′‐TCA GTG TGC ATC GAA TCA T‐3′; guide‐4: 5′‐TGC ATC GAA TCA TCG GGC GT‐3′) were cloned into lentiCRISPR v2 plasmid (Addgene#52961). To produce lentivirus, 293FT (3 × 106 cells) seeded in 10‐cm plates were transfected with 8 μg lentiCRISPR v2 plasmid, 4 μg pCMV‐VSV‐G (Addgene#8454), 4 μg psPAX2 (Addgene#12260) and 48 μl of 1 mg/ml polyethylenimine (Polysciences). Lentivirus was collected 60 h posttransfection and filtered using a 0.45‐μm low‐protein binding membrane (Pall Corporation). Flp‐In‐3T3 cells were transduced twice with the lentivirus for 48 h and later selected in puromycin‐containing DMEM (2 μg/ml) for 10 days.
4
Lentiviral CRISPR Vector Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct the lentiV2-EF1a-nCas9/RT plasmid, we first excised the U6-sgRNA cassette from the lentiCRISPR v2 plasmid (Addgene, 52961) by dual KpnI and EcoRI digestion followed by blunt end ligation. We further replaced the Cas9 cassette with an nCas9/M-MLV-RT cassette from the pCMV-PE2 plasmid (Addgene, 132775). The lentiV2-pegRNA and lentiV2-ngRNA plasmids were constructed by replacing the Cas9 and Puromycin sequences in the lentiCRISPR v2 plasmid (Addgene, 52961), with hygromycin B and EGFP sequences. RNA motifs and sgRNA scaffolds were further integrated by Gibson assembly.
5
Lentiviral CRISPR Targeting Krt19 and Tgm2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The control CRISPR guide [sgScramble: GCTTAGTTACGCGTGGACGA (25 (link))] and the guides targeted to the mouse Krt19 gene (sgKRT19 [1]: CACAGGAAATTACTGCCCTG; sgKRT19 [2]: TAGTGGTTGTAATCTCGGGA; sgKRT19 [3]: CGGAGGACGAGGTCACGAAG) or mouse Tgm2 gene (sgTGM2 [1]: GAATATGTCCTTACGCAACA; sgTGM2 [2]: GTCCTGTTGGTCCAGCACTG; sgTGM2 [3]: TTGACCTCGGCAAACACGAA) were cloned into the lentiCRISPR-v2 plasmid (Addgene, 52961) and sequencing validated. The lentivirus was produced by cotransfecting HEK293T cells with the guide containing lentiCRISPR-v2 plasmid together with the lentivirus-packing plasmid psPAX2 (Addgene, 12260) and the envelope-expressing plasmid pMD2.G (Addgene, 12259).
6
Analyzing Cellular Signaling Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All information regarding antibodies used in this study is provided in Table S7 . Rapamycin (Rapa), everolimus (RAD001), deferoxamine (DFX), DAPT and MHY1485 were purchased from Selleck Chemicals (Houston, TX, USA). Jagged1-Fc was obtained from R&D system (Minneapolis, MN, USA). Lipofectamine RNAiMax was obtained from Invitrogen (Carlsbad, CA, USA). pRL-TK, pGL3-Basic, pcDNA3.0, pcDNA3.0-HA-HIF-1α, lenti-CRISPRv2 plasmids and packaging vectors (pVSVG and psPAX2) were purchased from Addgene (Cambridge, MA, USA).
7
Generation of GBP1 Knockout PK-15 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CRISPR-Cas9 methodology was used to generate GBP1 deletion cells in PK-15 cells as previously described [31 (link)]. Three pairs of gRNA specifically targeting the porcine GBP1 were designed respectively using the optimized CRISPR design tool [32 ]. Oligonucleotide pairs of target sequences were phosphorylated and annealed. The acquired fragments were then ligated into the BsmB I sites of lentiCRISPRv2 plasmids (52,961; Addgene) and confirmed with sequencing analysis (Sangon Biotech). The correct recombinant plasmids with the packaging plasmids psPAX2 (12,260; Addgene) and pMD2.G (12 259; Addgene) co-transfected into HEK293T cells to obtain the lentivirus. After 72 h, the culture supernatant was collected to infect PK-15 cells for 48 h. Then, the cells were selected by puromycin (InvivoGen) at a concentration of 5 µg per mL. The GBP1 KO cells were obtained after about 2 weeks. The cells obtained were subcloned into 96-well plates to get single-clone growth and saved as cell stocks.
8
CRISPR-mediated Knockout of VGLL1 and TEAD4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single guide RNAs (sgRNAs) targeting VGLL1 and TEAD4 exons were cloned into lentiCRISPR-v2 plasmids (Addgene, 52961) for KO cell line generation. H9 ESCs were transfected with sgRNA-coding plasmids using Lipofectamine 3000 (ThermoFisher) following the manufacturer’s instructions. Puromycin selection (1 µg/mL) was conducted 2 days post-transfection and continued for 1-2 days until control cells were dead. Single-cell derived clones were picked for further expansion and PCR-based genotyping was performed to test frameshift mutations. Homozygous KO were further confirmed by TA cloning followed by Sanger sequencing, and also by Western blotting. All sgRNA sequences are listed in Supplementary Table 2 . Primers used for genomic PCR are listed in Supplementary Table 3 .
9
CRISPR-Mediated PBRM1 Knockout in Renal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PBRM1 gene knockout was performed in786-O, Caki-1 cell lines using a CRISPR/Cas9-based gene editing technique. All sgRNAs were cloned into the lenti-CRISPR-V2 plasmids (Addgene plasmid #52961). Cells were transfected with the PBRM1 KO constructs using the lentiviral transduction. Then the transduced cells were selected by puromycin (Solarbio). Isolated KO clones were verified with Western blotting with and Sanger sequencing of the genomic PBRM1 locus. To produce lentiviruses, CRISPR-V2 plasmid, pMD2.G (Addgene plasmid # 12559) and psPAX2 (Addgene plasmid #12260) were co-transfected into HEK 293t cells using LentiFit (Hanbio). At 48 h post-transfection, cell supernatants were harvested and virus was concentrated using PEG-8000. The information of the primer sequences is available in Supplementary Table 1
10
CRISPR sgRNA Cloning in LentiCRISPRv2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR sgRNA guides were cloned in the LentiCRISPRv2 plasmid backbone as previously described (Sanjana et al, 2014 (link); Shalem et al, 2014 (link)). All oligo sequences used for generating CRISPR sgRNAs were obtained from the Brunello library. All LentiCRISPRv2 plasmids (expressing a selectable marker of resistance to puromycin, blasticidin, neomycin, or hygromycin) were purchased from Addgene and amplified according to instructions. LentiCRISPRv2 (puro) was a gift from Feng Zhang (Addgene plasmid # 52961). LentiCRISPRv2 hygro, LentiCRISPRv2 neo, and LentiCRISPRv2 blast were gifts from Brett Stringer (Addgene plasmids # 98291, 98,292, 98,293).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!