The largest database of trusted experimental protocols

Mir 582 5p inhibitor

Manufactured by RiboBio
Sourced in China

The MiR-582-5p inhibitor is a laboratory product designed to inhibit the expression of the miR-582-5p microRNA. This inhibitor can be used in research studies focused on the regulation and function of miR-582-5p in various cellular and biological processes.

Automatically generated - may contain errors

3 protocols using mir 582 5p inhibitor

1

Overexpression and Silencing of Key Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
For ATG7 overexpression, ATG7 mRNA sequence was synthesized and subcloned into the mammalian expression vector pcDNA3.1 (Invitrogen), and the empty pcDNA3.1 vector served as a negative control. shRNA against UCA1 (UCA1 shRNA) were obtained from Ribobio. miR-582-5p mimic, mimic mock, and miR-582-5p inhibitor were purchased from Ribobio. Plasmid, shRNA, or mimic transfection was performed by using Lipofectamine3000 reagent (Invitrogen) according to the manufacturer’s protocol.
+ Open protocol
+ Expand
2

Transfection of HL-1 Cells for OGD

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cell transfection procedures were performed as previously described.41 MiR‐582‐5p inhibitor, miR‐582‐5p mimic, small interfering RNA (siRNA) against Creb1 (siRNA), and the corresponding negative controls were purchased from RIBOBIO. Lipofectamine 3000 transfection reagent was used for all transfections procedures according to the manufacturerʼs instructions (Cat: L3000015; Invitrogen).42 Briefly, HL‐1 cells were seeded into six‐well plates overnight until they reached 50%–60% confluence. Oligonucleotides were mixed into lipofectamine 3000 reagents for 5 min at RT, followed by the addition of the Opti‐MEM to a final concentration of 50 nM. The cells were subjected to OGD after transfection for 24 h. The corresponding oligonucleotides sequences are as follows:
Creb1‐siRNA‐F: 5′‐GGCUAACAAUGGUACGGAUTT‐3′, Creb1‐ siRNA‐R: 5′‐AUCCGUACCAUUGUUAGCCTT‐3′; miR‐582‐5p mimic‐F: 5′‐AUACAGUUGUUCAACCAGUUAC‐3′, miR‐582‐5p mimic‐R: 5′‐AACUGGUUGAACAACUGUAUUU‐3′, MiR‐582‐5p inhibitor: 5′‐GUAACUGGUUGAACAACUGUAU‐3′.
+ Open protocol
+ Expand
3

Transfection and OGD Treatment in HCMs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Before transfection, shF2RL2, shRNA for lncRNA NEAT1 (shlncNEAT1), shNC, miR-582-5p mimic (M), mimic control (MC), miR-582-5p inhibitor (I), and inhibitor control (IC) were synthesized by RiboBio (Guangzhou, China). Then, the HCMs were cultured in 6-well plates until the cell confluence reached about 80%. Next, the above shRNA, miR-582-5p inhibitor, or miR-582-5p mimic was transfected into the cells using Lipofect transfection reagent (CZ0002, Leagene Biotechnology) for 48 h. Finally, the cells were collected for OGD treatment or further experiments.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!