Hpaii

To identify the methylated Xi, 200 ng of DNA was digested overnight at 37°C with methylation-sensitive enzymes HpaII and HhaI (Invitrogen). To discriminate between the two parental X-chromosomes, 20 ng of digested and undigested DNA was amplified with primers spanning the heterozygous polymorphic trinucleotide repeat in the first exon of the AR gene for 32 cycles. The 5′ end of the forward primer was labelled with FAM fluorescein (Invitrogen). PCR products were separated on an ABI3100 Genetic Analyzer with 500 LIZ size standard and analysed by Peak Scanner software (all from Applied Biosystems). XCI ratio (Table S1) was calculated as previously described (Cheung et al., 2011b (link)).

Genomic DNA was extracted from the frozen‐matched pairs of OSCC tumor and marginal normal epithelium tissues by a Genomic DNA Mini Preparation Kit with Spin Column (Beyotime, D0061, Shanghai, China), according to the manufacturer's protocol. The DNA samples were separately digested with HpaII and MspI (Thermo, Dalian, China). HpaII and MspI recognize the same restriction site (CCGG) but have different sensitivities to cytosine methylation. HpaII cannot cleave DNA if the cognate restriction sites are methylated, while MspI can cleave every restriction site regardless of its methylation. Then, the methylated and unmethylated rDNA promoters were roughly detected by qRT‐PCR with the digested DNA as a template. After digested by HpaII, there would be more qRT‐PCR products in the samples with high level of methylation than those in the samples with low‐level methylation.

The ESSE site was generated from the ESSE pGL3 reporter vector with the use of PCR primers 5'GTAGAAGGTACCTTGAGCAGGATAGTGGCATG and 5'GAGAAGAGCTCCTCGAGCCCAGCAACCCTTTTAG. The PCR product was inserted into pGL4.23 reporter vector (luc2/minP; Promega) upstream or downstream to the minimal promoter and the Firefly luciferase reporter gene after digestion with Acc65I and SacI. Complete in vitro CpG methylation of the ESSE pGL4.23 vector was performed with CpG Methyltransferase (M.SssI; Thermo Scientific), which was protected from HpaII (Thermo Scientific) digestion. A total 5x10⁵ K562 leukemia cells were co-transfected with 1.8 mg of empty pGL4.23 vector, ESSE pGL4.23 vector, methylated empty pGL4.23 vector or methylated ESSE pGL4.23 vector together with 130 ng of renila expressing plasmid.

Genomic DNA was extracted from frozen CIN and noncancerous tissues obtained from the patients above, according to the manufacturer’s protocol (Beyotime, D0061, Shanghai, China). Then DNA samples were separately digested with HpaII and MspI (Thermo, Dalian, China) according to the instruction of manufacturer, and then detected by RT-PCR. The primers were 5'-TCC GTG TGT GGC TGC GAT-3' (sense) and 5'-CAG GAC AGC GTG TCA GCA AT-3' (antisense).

To analyze the DNA methylation during early HSC activation within different repetitive elements we used the qAMP (quantitative analysis of DNA methylation using real-time PCR) method as described [26 (link)]. In principle, 300 ng genomic DNA were either restricted for 1h at 37°C with methylation-sensitive restriction enzymes like HhaI and HpaII (Thermo Scientific), which can only cleave unmethylated recognition sites, or DNA was treated without any enzyme (mock), accordingly. After digestion 2.5 ng DNA per sample were subjected to qPCR and the amount of digested DNA compared to mock-treated DNA was quantified. For primer design the consensus sequences of repetitive DNA elements were obtained from RepBase database (http://www.girinst.org/repbase) and primer3 software (http://primer3.ut.ee) was used (S4 Table). All samples were measured in triplicates and mock treated DNA was set to 100% DNA methylation.