Itaq universal sybr green

Manufactured by Bio-Rad

Sourced in United States

ITaq Universal SYBR Green is a real-time PCR master mix that enables accurate and reliable detection and quantification of target DNA sequences. It contains a hot-start Taq DNA polymerase, optimized buffer, and SYBR Green I dye for fluorescent detection of PCR products.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (21 mentions) Iscript cdna synthesis kit, by Bio-Rad (21 mentions) Rneasy mini kit, by Qiagen (14 mentions) Trizol, by Thermo Fisher Scientific (14 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (9 mentions) Superscript 3, by Thermo Fisher Scientific (6 mentions) Cfx96 touch real time pcr detection system, by Bio-Rad (5 mentions) First strand cdna synthesis kit, by Thermo Fisher Scientific (5 mentions) Rnaiso plus, by Takara Bio (5 mentions) Nanodrop, by Thermo Fisher Scientific (4 mentions) Eco real time pcr system, by Illumina (4 mentions) Cfx connect real time pcr detection system, by Bio-Rad (4 mentions) Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (3 mentions) Cfx96 real time pcr detection system, by Bio-Rad (3 mentions) Iscript reverse transcriptase, by Bio-Rad (3 mentions) Cfx96 touch real time pcr system, by Bio-Rad (3 mentions) Lightcycler 96, by Roche (3 mentions) M mlv reverse transcriptase, by Thermo Fisher Scientific (3 mentions) Cfx96, by Bio-Rad (3 mentions) Iscript cdna kit, by Bio-Rad (3 mentions)

Close spelling variants of this product

SYBR Green (1276 citations) ITaq Universal SYBR Green Supermix kit (121 citations) ITaq SYBR Green (82 citations) ITaq Universal SYBR Green kit (24 citations) ITaq Universal SYBR Green Supermix (2×) (11 citations) ITaqTM Universal SYBR® Green Supermix Kit reagents (6 citations) Universal SYBR Green (5 citations) ITaq Universal SYBR Green Supermix and Bradford Protein Assay (4 citations) ITaq Universal SYBR Green Supermix with ROX (4 citations) ITaq Universal SYBR Green Supermixes (4 citations)

125 protocols using itaq universal sybr green

Gene expression analysis in Drosophila under metal stress

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

After flies (3 to 4 d old) were exposed to fly media mixed with 10 mM CuSO₄, 10 mM ZnSO₄, or ddH₂O for 24 h, fly heads were collected using forceps and placed immediately into collection tubes kept cold in liquid nitrogen. Head tissues were then ground in 500 μL RLT lysis buffer (Qiagen) on ice. RNA was extracted with acid phenol and Direct-zol RNA microprep kits (Zymo Research) according to the manufacturer’s protocol. Complementary DNA was synthesized with EpiScript (Lucigen) and added to the iTaq Universal SYBR Green (Bio-Rad) system for qPCR. Target gene expression was normalized to the level of RP49 transcripts. Primers are provided below, with sequences adopted from refs. 84 (link)–86 (link, link):

RP49fwd (CCAAGCACTTCATCCGCCACC)

RP49rev (GCGGGTGCGCTTGTTCGATCC)

Gr33afwd (CCACCATCG CGGAAAATAC)

Gr33arev (ACACACTGTGGTCCAAACTC)

Gr66afwd (ACAGGAATCAG TCTGCACAA)

Gr66arev (AATGTTTCCATGTCCAGGGT)

Ir25afwd (CAATCCACTCAGCCATTCAA)

Ir25arev (ACCAGAGGCACTCCTTCAGA)

Ir76bfwd (CAGCGCAGCTTCGTCTACTA)

Ir76brev (CACAAAGTGCTTGTTCTTCG)

MtnAfwd (ACTGCGGATCTGACTGCAAG)

MtnArev (AAGATGCAGCGCCTCTACTC)

Xiao S., Baik L.S., Shang X, & Carlson J.R. (2022). Meeting a threat of the Anthropocene: Taste avoidance of metal ions by Drosophila. Proceedings of the National Academy of Sciences of the United States of America, 119(25), e2204238119.

+ Open protocol

+ Expand

miRNA and mRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA for miRNA and mRNA was prepared separately using 1000ng of RNA. mRNA cDNA was synthesized with the SuperScript III First-Strand Kit (Life Technologies) and miRNA cDNA was synthesized with the miScript II RT Kit (QIAGEN) using the HiSpec buffer following the recommended manufacturer's protocol. All qPCR was performed in 384-well plates on an ABI ViiA7 machine using iTaq Universal SYBR Green (Bio-Rad) or QuantiTect SYBR Green (QIAGEN) for mRNA and miRNA respectively. Data was normalized to expression of 18S and U6. Forward miRNA primer and forward and reverse mRNA primer sequences are listed in Supplementary Table S2.

Farina N.H., Zingiryan A., Akech J.A., Callahan C.J., Lu H., Stein J.L., Languino L.R., Stein G.S, & Lian J.B. (2016). A microRNA/Runx1/Runx2 network regulates prostate tumor progression from onset to adenocarcinoma in TRAMP mice. Oncotarget, 7(43), 70462-70474.

+ Open protocol

+ Expand

WNV Viral RNA Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from cells with Trizol Reagent (Life Technologies) by following the manufacturers’ protocol. SuperScript III Reverse Transcriptase (Invitrogen) and strand specific primers for WNV_KUN was used to generate cDNA for viral positive and negative sense RNA, and GAPDH as the internal control. qRT-PCR was performed with ITaq Universal SybrGreen (Bio-Rad), 10 μM forward and reverse primers and various templates.

Liebscher S., Ambrose R.L., Aktepe T.E., Mikulasova A., Prier J.E., Gillespie L.K., Lopez-Denman A.J., Rupasinghe T.W., Tull D., McConville M.J, & Mackenzie J.M. (2018). Phospholipase A2 activity during the replication cycle of the flavivirus West Nile virus. PLoS Pathogens, 14(4), e1007029.

+ Open protocol

+ Expand

Quantifying Gene Expression via qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells using Trizol Reagent (Invitrogen), and cDNA was made using SuperScript II Reverse Transcriptase (ThermoFisher), according to manufacturer’s instructions. qPCR was performed using iTaq Universal SyBR Green (BioRad), samples were run and analysed on a BioRad CFX96 Real-Time PCR detection system. Primer sequences were as follows.
MUS81 forward: 5′ GCTGCTCCGAGAGCTACAG 3′ MUS81 reverse: 5′ CAGGGTTTGCTGGGTCTCTA 3′ SLX4 forward: 5′AGTGTGCTGTGAAGATGGAG 3′ SLX4 reverse: 5′ CCGTTTCAGACCTCTACTGTG 3′ ACTB forward: 5′ CGTCACCAACTGGGACGACA 3′ ACTB reverse: 5′ CTTCTCGCGGTTGGCCTTGG 3′

van Wietmarschen N., Sridharan S., Nathan W.J., Tubbs A., Chan E.M., Callen E., Wu W., Belinky F., Tripathi V., Wong N., Foster K., Noorbakhsh J., Garimella K., Cruz-Migoni A., Sommers J.A., Huang Y., Borah A.A., Smith J.T., Kalfon J., Kesten N., Fugger K., Walker R.L., Dolzhenko E., Eberle M.A., Hayward B.E., Usdin K., Freudenreich C.H., Brosh RM J.r., West S.C., McHugh P.J., Meltzer P.S., Bass A.J, & Nussenzweig A. (2020). Repeat expansions confer WRN dependence in microsatellite-unstable cancers. Nature, 586(7828), 292-298.

+ Open protocol

+ Expand

Gene Expression Analysis of Drosophila Memory

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA was generated from RNA samples using the QuantiTect Reverse Transcription Kit (Qiagen). The iTaq Universal SYBR Green (BioRad) was used for the PCR reaction, and all primers were validated with standard curve before use (S10 Table). Gene specific data was normalized to actin and log₂ fold change was calculated using the delta-delta CT method. An additional time point was collected post-memory formation: Following the 4 days of exposure, flies were separated from wasps and allowed to recover for 24 hours in a new vial before collection. All other time-points used RNA from the sequencing samples. Significance was determined by a two-tailed t-test. Statistical calculations were preformed in R (version 3.0.2 “Frisbee Sailing”).

Bozler J., Kacsoh B.Z., Chen H., Theurkauf W.E., Weng Z, & Bosco G. (2017). A systems level approach to temporal expression dynamics in Drosophila reveals clusters of long term memory genes. PLoS Genetics, 13(10), e1007054.

+ Open protocol

+ Expand

Quantitative miRNA and mRNA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA for miRNA and mRNA was prepared separately using 1000ng of RNA. MiRNA cDNA was made with the miScript II RT Kit (QIAGEN) using the HiSpec buffer and mRNA cDNA with the SuperScript III First-Strand Kit (Thermo Fisher Scientific, Waltham, MA) following the recommended manufacturer’s protocol. All qPCR was performed in 384-well plates on an ABI ViiA7 machine (Thermo Fisher Scientific) using iTaq Universal SYBR Green (BioRad) Hercules, CA or QuantiTect SYBR Green (QIAGEN) for mRNA and miRNA respectively. Data were normalized to expression of HPRT1 (Forward 5’ - TCAGTCAACGGGGGACATAAA - 3’, Reverse 5’ - GGGGCTGTACTGCTTAACCAG - 3’) and U6 (5’ - ACGCAAATTCGTGAAGCGTTCCATATT - 3’).

Zingiryan A., Farina N.H., Finstad K.H., Stein J.L., Lian J.B, & Stein G.S. (2016). Dissection of individual prostate lobes in mouse models of prostate cancer to obtain high quality RNA. Journal of cellular physiology, 232(1), 14-18.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using the RNeasy Midi Kit (QIAGEN). Purified RNA was reversed transcribed to cDNA using Maxima H Minus First Strand cDNA Synthesis Kit (Promega). The sequences of the primers used are given in Table S9. qRT-PCR was performed using iTAq Universal SYBR Green (Bio-Rad) according to the manufacturer's instructions. At least two independent experiments were performed for each condition. The relative expression levels of mRNA were normalized to RPLP0 mRNA expression and evaluated according to the 2^−ΔΔCt method (Rao et al., 2013 ).

Recoules L., Heurteau A., Raynal F., Karasu N., Moutahir F., Bejjani F., Jariel-Encontre I., Cuvier O., Sexton T., Lavigne A.C, & Bystricky K. (2022). The histone variant macroH2A1.1 regulates RNA polymerase II-paused genes within defined chromatin interaction landscapes. Journal of Cell Science, 135(7), jcs259456.

+ Open protocol

+ Expand

Genotyping and qPCR Protocols for Mouse and Human Vitamin C Transporters

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR Genotyping primers:

Gulo: 5′-CCCAGTGACTAAGGATAAGC-3′, 5′-CGCGCCTTAATTAAGGATCC-3′, 5′-GTCGTGACAGAATGTCTTGC-3′. Wild type band= 343bp, knockout band= 230bp.

Slc23a2⁻: 5′-GGCAGTGTTGGTCCTTCTGT-3′, 5′-CTGGCTATCCTCGTGTCCTG-3′ 5′-CTTAAACCATGGGGCTACCA-3′, 5′-AGACTGCCTTGGGAAAAGCG-3′, wild type band= 140bp, knockout band= 180bp

Tet2^fl and Flt3^ITD genotyping were as previously described ^{27 (link),49 (link)}.
For qPCR, cells were sorted into RLT buffer (Qiagen RNAeasy Micro kit) and RNA was purified according to the manufacturer’s instructions. cDNA was made with iScript reverse transcriptase (BioRad) and quantitative PCR was performed with iTaq Universal SYBR Green (BioRad) and a LightCycler 480 (Roche Applied Science). The signal from each sample was normalized to β-actin. qPCR primers:

Mouse Slc23a2: 5′-GGACAACACCATCCCAGGTA-3′, 5′-CCTTTGCTCACACCCTTCTT-3′.

Mouse Slc23a1: 5′-GAAGCCACCTCAATGAAAGG-3′, 5′-GCTGAGATCTCCAACTCAGGTC-3′.

Mouse β-actin: 5′-CACTGTCGAGTCGCGTCC-3′, 5′-TCATCCATGGCGAACTGGTG-3′

Human SLC23A2: 5′-CTGCAGCCAGCTAGGTCTTG-3′, 5′-AAGCTAGGAGCCCAGGATCA-3′

Human SLC23A1: 5′-TCCTCCTCCTTGGCCTTTGT-3′, 5′-CCCTGGTGGTTTCATGCTGT-3′

Human β-ACTIN: 5′-ATTGGCAATGAGCGGTTC-3′, 5′-CGTGGATGCCACAGGACT-3′

Agathocleous M., Meacham C.E., Burgess R.J., Piskounova E., Zhao Z., Crane G.M., Cowin B.L., Bruner E., Murphy M.M., Chen W., Spangrude G.J., Hu Z., DeBerardinis R.J, & Morrison S.J. (2017). Ascorbate regulates haematopoietic stem cell function and leukaemogenesis. Nature, 549(7673), 476-481.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were lysed in TRIzol and RNA was purified with either RNeasy Mini Kits or Direct-zol RNA MiniPrep Kits. cDNA was produced using SuperScript III (Invitrogen) and qRT-PCR assays were performed using TaqMan Gene Expression Master mix (Applied Biosystems) and iTaq Universal Sybr Green (Bio-Rad) using primers or Taqman assays listed in Table S7.

Chen Y., Anastassiadis K., Kranz A., Stewart A.F., Arndt K., Waskow C., Yokoyama A., Jones K., Neff T., Lee Y, & Ernst P. (2017). MLL2, not MLL1, Plays a Major Role in Sustaining MLL-rearranged Acute Myeloid Leukemia. Cancer cell, 31(6), 755-770.e6.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis of HCP5, miR-216a-5p, and CDC42

Check if the same lab product or an alternative is used in the 5 most similar protocols

According to the manufacturer's instructions, the total RNA of the human cervical cancer tissues and cell lines were extracted using the TRIzol reagent (Invitrogen). According to the manufacturer's protocol reverse transcription (RT) was performed with the HiScript®II Q RT SuperMix (Vazyme, Nanjing, China). According to the manufacturer's instructions, the real-time quantitative polymerase chain reaction (qPCR) was performed using the BIORAD CFX96 Touch Real-time PCR System and iTaq universal SYBR Green (Bio-Rad, USA). The expression levels of HCP5, miR-216a-5p, and CDC42 were calculated with the 2^-ΔΔCt method. U6 and GAPDH were used as the internal references for target genes, respectively. The expression levels of the target genes were normalized to the corresponding control. Primers for miR-216a-5p and U6 were purchased from GUANG ZHOU RIBO BIOTECHNOLOGY Co., Ltd. The other primers were shown as follows: HCP5 forward primers: 5ʹ-GCTGGACGATTCTCCTCACACT-3ʹ, reverse primers: 5ʹ-CTCCTCTCCAGGCACAGGTAAT-3ʹ; CDC42 forward primers: 5ʹ-GCTCTAGACCCTTAAGGGGAGGAG-3ʹ, reverse primers: 5ʹ-GCTCTAGAAAAAATCCCTATTAACAC-3ʹ.

Li X., Chen B., Huang A., Ren C., Wang L., Zhu T., Xiong J., Ding W, & Wang H. (2022). LncRNA HCP5 enhances the proliferation and migration of cervical cancer via miR-216a-5p/CDC42 axis. Journal of Cancer, 13(6), 1882-1894.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!