Pzero 2

To create cDNA clones for CrLAT1 OE, RNA was prepared by the phenol/chloroform method from C. reinhardtii strain CC-408. Reverse transcription was conducted with Superscript II reverse transcriptase (Invitrogen, Waltham, MA, USA) to obtain cDNA. CrLAT1 was amplified by PCR from cDNA using PrimeSTAR GXL DNA Polymerase (Takara, Shiga, Japan) and the primer sets containing PstI and EcoRI restriction sites are shown in Supplemental Table S7. The PCR products were cloned into pZErO-2 (Invitrogen). To construct the OE plasmid, PstI and EcoRI restriction sites were replaced with the truncated miRNA precursor cre-MIR1157 in pChlamiRNA3 (Molnar et al., 2009 (link)). After DNA sequencing, the PCR products and the modified pChlamiRNA3 vector were digested with restriction endonucleases PstI and EcoRI and ligated using Mighty Mix (Takara). Additional DNA sequencing was carried out to confirm the vector construct, which was then transformed into C. reinhardtii strain CC-4533 by electroporation as described (Iwai et al., 2014 (link)). The modified pChlamiRNA3 vector, which resulted in removal of the truncated miRNA precursor cre-MIR1157, was used as the VC. Transformants were selected on TAP plates with paromomycin (10 μg mL⁻¹).

A commercial viral RNA extraction and purification kit (Qiagen, Hilden, Germany) was used to extract viral genomic RNA from serum, PBMCs and clarified tissue homogenates. A commercial one-step RT-PCR kit (Qiagen, Hilden, Germany) and a consensus oligonucleotide primer-pair (Sense: 5′-CACCCTTGTGATACCATGGATCAG-3′, Anti-sense: 5′-GTGAATTAAGAACRCAYCGTGTYT-3′) that amplified the proximal third of the VP1 gene from all EV-A71 subgenogroups were used for molecular amplification and detection of EV-A71-specific viral RNA after extraction from tissues. Eighteen pairs of sequence-specific primers, based on the complete genomic sequence of EV71:TLLβ, were used to amplify and sequence the complete genome of EV-A71 present in the sera of two monkeys obtained on day 4 and day 8 PI. Any PCR-amplified fragment that failed to give a good sequence read by direct sequencing was cloned into pZero-2 (Invitrogen, Calrsbad, CA, USA) and transformed into TOP10 E. coli. At least ten colonies were selected from each transformant and sequencing was performed on the purified plasmids carrying the inserts.

Three sets of plasmids were generated to construct M. xanthus strains. The first set were constructs to delete single or multiple pil genes; these include pWB525 (ΔpilA), pWB581 (ΔpilB), pWB555 (ΔpilBTC), pWB556 (ΔpilAGHI), pWB605 (ΔpilGHI) and pWB557 (ΔpilMNOPQ). The second were for the expression of pil gene clusters and pilB alleles in M. xanthus; these constructs, which integrate at Mx8 att site^{76 (link)}, include pWB559 (pilGHI), pWB565 (pilMNOPQ) and pWB566 (pilBTC) as well as pWB571 (pilB), pWB572 (pilB*), pGD5 (pilBWA) and pGD6 (pilBWB). The third includes the plasmid pWB606, which was used for the replacement of wild-type pilB with pilB*. The first and third sets were derivatives of pBJ113^{77 (link)}. The second set used pWB425 as the cloning and M. xanthus expression vector³⁹ . pWB425 contains a BspHI/ApoI fragment from pZero-2 (Invitrogen) with the kanamycin resistance (Kan^R) gene and its promoter. The expression of all pil genes cloned into pWB425 is driven by this promoter because the multicloning site is immediately downstream of the Kan^R gene in this plasmid.

The DNA fragment coding for BLSVP8d, in which VP8d is fused to the N-termini of BLS, was obtained from pET-BLS-VP8d (Bellido et al., 2009 (link)) by PCR with Pfu DNA polymerase (Invitrogen, Carlsbad, USA) using primers BLSVP8dNdeI (5′ CCCATATGCATGAACCAGTGCTTG 3′) and BLSVP8dXbaI (5′ CCTCTAGATCAGACAAGCGCGATGC 3′). Primers included NdeI and XbaI restriction sites to allow further cloning. The amplification product was subcloned into pZErO-2 (Invitrogen Life Technologies, Carlsbad, SD, USA) and sequenced. BLSVP8d was released by enzymatic digestion with NdeI and XbaI, gel purified and cloned into chloroplast transformation vector pBSW-utr/hEGF (Wirth et al., 2006 (link)), which was previously digested with NdeI and XbaI to excise the hEGF sequence. The resulting construction was named pBSW-utr/BLSVP8d and carries the BLSVP8d sequence under the control of the promoter and 5′-untranslated region of the tobacco psbA gene (5′psbA) and downstream the aadA sequence that confers spectinomycin resistance, under the transcriptional control of the rrn promoter (Prrn). Flanking regions were included to allow homologous recombination with N. tabacum plastome (GenBank accession number NC 001879). The left flanking region (LFR) included the 3′ region of rrn16, and the right flanking region (RFR) contained the full trnI and the 5′region of trnA, all from N. tabacum.