Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA). An RNA denaturation mix consisting of isolated RNA, oligo dT primers, and nuclease-free water was denatured. Reverse transcription polymerase chain reaction (RT-PCR) was performed using oligonucleotide primers specific to MMP-1 (forward primer, TGC AAC TCT GAC GTT GAT CCC AGA; reverse primer, ACT GCA CAT GTG TTC TTG AGC TGC; 122 bp), to MMP-3 (forward primer, CTG GGC CAG GGA TTA ATG GAG; reverse primer, CAA TTT CAT GAG CAG CAA CGA GA; 102 bp) or to MMP-9 (forward primer, ATT TCT GCC AGG ACC GCT TCT ACT; reverse primer, CAG TTT GTA TCC GGC AAA CTG GCT; 195 bp). Two reactions were run in parallel with a second reaction containing only Platinum Taq polymerase to assure that the source of the RT-PCR product was mRNA. Complementary DNA was synthesized by adding prime RT premix, Taq Green Master Mix (Thermo Scientific, Carlsbad, CA, USA), and 10 pM of each forward and reverse primer. The amplification reaction was carried out for 30 cycles on a DNA Engine Cycler (Bio-Rad, Hercules, CA, USA). The amplified PCR products were analyzed using Multi Gauge software (Fujifilm, Tokyo, Japan) after electrophoresis. The level of b-actin was used as an internal standard.
Dna engine cycler
Manufactured by Bio-Rad
Sourced in United States
The DNA Engine Cycler is a thermal cycling instrument designed for performing polymerase chain reaction (PCR) amplification of DNA samples. It features a precise temperature control system and can accommodate a variety of sample volumes and formats.
Automatically generated - may contain errors
Lab products found in correlation
Multi gauge software, by Fujifilm (4 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Taq green master mix, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Multiplex pcr plus kit, by Qiagen (1 mentions)
Prime rt premix, by GeNet Bio (1 mentions)
Taq green master mix, by Promega (1 mentions)
Taq polymerase, by Qiagen (1 mentions)
Pcr buffer, by Qiagen (1 mentions)
Q solution, by Qiagen (1 mentions)
7 protocols using dna engine cycler
1
Quantitative RT-PCR Analysis of MMPs
2
Multiplex STR Genotyping Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In both studies, the sixteen selected STRs were genotyped in two multiplex PCRs (see Table S2 & Figure S1 in File S1 ). Primers were designed with Visual OMP (DNA Software, Ann Arbor, MI) and HPLC-purified primers were purchased from Microsynth (Balgach, Switzerland). Forward primers were labeled with FAM, YY (Yakima Yellow), ATTO 550, and AT565.
The sequences were checked for existing null alleles, which could cause scoring errors and deviations from Hardy-Weinberg equilibrium by using the software Micro-Checker [26] (link) (http://www.microchecker.hull.ac.uk/ ). The Hardy-Weinberg equilibrium was checked with ARLEQUIN [27] (http://cmpg.unibe.ch/software/arlequin3/ ).
The PCR was performed in 384 well plates in a total volume of 5 µl. The PCR mix contained 20 ng dried DNA, 2.5 µl Qiagen Multiplex PCR Plus Kit (Qiagen, Hilden, Germany), 1×Q solution (Qiagen, Hilden, Germany) and 1 µl primer-mix (final primer concentrations seeTable 2 ). The amplification reaction for both PCRs was conducted on a DNA Engine Cycler (BioRad, Hercules, CA, USA) under following conditions: initial denaturation 95°C 15 min; 95°C 30 sec, 66°C 90 sec, 72°C 30 sec (30 cycles); final extension 68°C 30 min.
The sequences were checked for existing null alleles, which could cause scoring errors and deviations from Hardy-Weinberg equilibrium by using the software Micro-Checker [26] (link) (
The PCR was performed in 384 well plates in a total volume of 5 µl. The PCR mix contained 20 ng dried DNA, 2.5 µl Qiagen Multiplex PCR Plus Kit (Qiagen, Hilden, Germany), 1×Q solution (Qiagen, Hilden, Germany) and 1 µl primer-mix (final primer concentrations see
3
Quantifying mRNA Expression via RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA). An RNA denaturation mix consisting of isolated RNA, oligo dT primers, and nuclease-free water was denatured. Reverse transcription polymerase chain reaction (RT-PCR) was performed using oligonucleotide primers specific to eNOS (forward primer, 5′-CTG GCT TTC CCT TCC AGT TC-3′, 225 bp, reverse primer 5′-CCT TCC AGA TTA AGG CGG AC-3′, 225 bp) or MMP-2 (forward primer, 5′-CTC GTG CCT TCCT AAG TCT GG-3′, 251 bp, reverse primer, 5′-GGC GTT CCC ATA CTT CAC AC-3′, 251 bp). Two reactions were run in parallel with a second reaction containing only Platinum Taq polymerase to assure that the source of the RT-PCR product was mRNA. cDNA was synthesized by adding prime RT premix, Taq Green Master Mix (Thermo Scientific, Carlsbad, CA, USA), and 10 pM of each forward and reverse primer. The amplification reaction was carried out for 30 cycles on a DNA Engine Cycler (Bio-Rad, Hercules, CA, USA). The amplified PCR products were analyzed using Multi-gauge software (Fujifilm, Tokyo, Japan) after electrophoresis. The level of b-actin was used as an internal standard.
4
Quantitative Analysis of MMP and TIMP mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with Trizol (Invitrogen). An RNA denaturation mix consisting of isolated RNA, oligo dT primers, and nuclease-free water was denatured. RT-PCR was performed using oligonucleotide primers specific to MMP-2, -3, -9, -14, and tissue inhibitor of metalloproteinase (TIMP)-1 and-2 mRNA (Table 1 ) [28 (link)]. Two tubes were run in parallel with the second tube containing only Platinum Taq polymerase to assure that the source of the RT-PCR product was mRNA. cDNA was synthesized by adding prime RT premix. Taq Green Master Mix and 10 pM each of forward and reverse primers was added to the synthesized cDNA. The amplification reaction was carried out for 30 cycles on a DNA Engine Cycler (Bio-Rad, Hercules, CA, USA). The amplified PCR products were analyzed using Multi-gauge software (Fujifilm, Tokyo, Japan) after electrophoresis. The level of β-actin was used as an internal standard.
5
RNA Expression Analysis of Lipid Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with Trizol (Invitrogen, Carlsbad, CA, USA). Northern blot analysis to measure the mRNA expression of lipoprotein lipase (LPL) and PPARγ2 was performed before and after the growth arrest to evaluate the effects of PGs on early differentiation. Briefly, an RNA denaturation mix composed of isolated RNA, oligo dT primer, and nuclease-free water was used to denature the RNA. The polymerase chain reaction (PCR) primer pairs for cDNA amplification were as follows: LPL (forward) 5'-TGCCGCTGTTTTGTTTTACC-3' and (reverse) 5'-TCACAGTTTCTGCTCCCAGC-3', PPARγ2 (forward) 5'-TGCCGCTGTTTTGTTTTACC-3' and (reverse) 5'-AATCAGCAACCATTGGGTCA-3'. cDNA was synthesized by adding prime RT premix (Genet Bio). Taq Green Master Mix (Promega, Madison, WI, USA) and 10 pmol of forward primer and reverse primer were added to the synthesized cDNA, and amplified with annealing for 30 cycles with DNAEngine cycler (Bio-Rad, Hercules, CA, USA). The DNA band of amplified PCR products was analyzed by multi-Gauze (Fujifilm, Tokyo, Japan) after electrophoresis. The level of β-actin was used as an internal standard.
6
Quantification of eNOS and MMP-2 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After exposure to each drug, total RNA was extracted with Trizol (Invitrogen, Carlsbad, CA, USA). An RNA denaturation mix consisting of isolated RNA, oligo dT primers, and nuclease-free water was denatured. RT-PCR was performed using oligonucleotide primers specific to eNOS and MMP-2. Two tubes were run in parallel with the second tube containing only Platinum Taq polymerase to assure that the source of the RT-PCR product was mRNA. cDNA was synthesized by adding prime RT premix. Taq Green Master Mix and 10 pM each of forward and reverse primers (eNOS: forward primer, ctg gct ttc cct tcc agt tc, 225 bp; reverse primer, cct tcc aga tta agg cgg ac, 225 bp) (MMP-2: forward primer, ctc gtg cct tcct aag tct gg, 251 bp; reverse primer, ggc gtt ccc ata ctt cac ac, 251 bp) were added to the synthesized cDNA. The amplification reaction was carried out for 30 cycles on a DNA Engine Cycler (Bio-Rad, Hercules, CA, USA). The amplified PCR products were analyzed using Multi-gauge software (Fujifilm, Tokyo, Japan) after electrophoresis. β-actin was used as an internal standard.
7
Haptoglobin Genotyping by Allele-Specific PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Haptoglobin genotype was determined by PCR as described previously24 (link) with slight modifications. In brief, 20 μL reactions contained 20 ng genomic DNA, 2 units Qiagen Taq Polymerase (Qiagen), 1× Qiagen PCR buffer (Qiagen, Hilden, Germany), 1× Q solution (Qiagen), 200 μmol/L of each dNTP (Peqlab) and 0.25 μmol/L of each primer (A/B or C/D). Oligonucleotide primers A and B were used for amplification of a 1757‐bp Hp 1 allele‐specific sequence and a 3481‐bp Hp 2 allele‐specific sequence. Primers C and D were used to amplify a 349‐bp Hp 2 allele‐specific sequence. The primers A (5′‐GAGGGGAGCTTGCCTTTCCATTG‐3′), B (5′‐GAGATTTTTGAGCCCTGGCTGGT‐3′), C (5′‐CCTGCCTCGTATTAACTGCACCAT‐3′) and D (5′‐CCGAGTGCTCCACATAGCCATGT‐3′) were purchased from Microsynth. The amplification reactions were conducted on a DNA Engine Cycler (BioRad) under the following conditions: initial denaturation 3 minutes 94°C; 94°C 30 seconds, 57°C (primers A/B) and 62°C (primers C/D) 30 seconds, 72°C 2 minutes, 35 cycles; final extension 10 minutes 72°C. After amplification 8 μL PCR product A/B and 2 μL PCR product C/D were mixed and separated together on a 1% agarose gel.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!