Minibest agarose gel dna extraction kit v4

Real-time PCR was carried out using a QuantiNova SYBR Green PCR kit (QIAGEN, Shanghai, China) in accordance with the manufacturer's instructions and by using an initial denaturation step at 95°C for 2 min, followed by 40 cycles with 10 s denaturation at 95°C and 30 s annealing at 60°C. PCR was carried out in an Applied Biosystems 7900 Real-Time PCR system (AB Applied Biosystems, Foster City, CA) by standard melting curve analysis. Negative controls were prepared by adding distilled water instead of the DNA template. The identity of the PCR products was verified by electrophoresis in 2% agarose gels and stained with 1 μl GelRed (Biosharp, Shanghai, China). After assessing molecular weight, each PCR product was purified using the Takara MiniBEST Agarose Gel DNA Extraction Kit v4.0 (Takara, Shiga, Japan), following the manufacturer's protocol, and finally verified by DNA sequencing (Majorbio Company, Shanghai, China).
In all RT-PCR experiments, a 142-bp GAPDH fragment was amplified as a reference housekeeping gene using the intron spanning primers, GAPDH-347 (GCACCGTCAAGGCTGAGAAC) and GAPDH-488 (ATGGTGGTGAAGACGCCAGT). Data were analyzed using the comparative ΔΔCT method, which calculates the difference between threshold cycle (CT) values of the target and reference genes from each sample and then compares the resulting ΔCT values between different samples.

The minigene splicing assay was performed to assess the effects of two intronic mutations in COL1A1 (c.805–2A > G) and COL1A2 (c.792+2T > G) on mRNA splicing. Target genome DNA fragments containing the mutated intron and the flanking upstream and downstream genome regions (exon10 to exon15 in COL1A1 and exon14 to exon18 in COL1A2) were cloned into pcDNA3.1 (+) vector at EcoRI and NotI sites. Point mutations were generated by site-directed mutagenesis and validated by Sanger sequencing. Purified COL1A1 and COL1A2 minigene constructs were transfected into HEK293T cells using polyethylenimine. RNA was extracted from transfected cells by TRIzol reagent (Invitrogen) after 24-h, and reversely transcribed into cDNA using PrimeScript RT reagent kit with gDNA Eraser (TakaRa). Spliced mature mRNA fragments can be amplified from the cDNA with specific COL1A1 (forward: 5′-TGGA AAA​CCT​GGT​CGT​CCT​GGT​GA-3′, reverse:5′-CCAGTAGCACCATCATTTCCACGA-3′) and COL1A2 (forward: 5′-TTC​CTG​GTG​AGA​GAG​GAC​GTG​TTG-3′, reverse:5′-CACCAGT AAG​GCC​GTT​TGC​TCC​A-3′) primers. Amplified PCR products were separated on 2% agarose gel and purified by MiniBEST Agarose Gel DNA Extraction Kit V4.0 (TaKaRa). The specific splicing pattern was determined by subsequent Sanger sequencing.