Ez1 virus mini kit

A European strain of CyHV-3, isolate K250, was propagated in the common carp brain (CCB) derived cell line (ECACC 10072802) at 20 °C in EMEM media supplemented with 2 mM Glutamine, 1% non-essential amino acids, 2% Fetal Bovine Serum (FBS) and 10 mM HEPES (Sigma-Aldrich, Gillingham, UK) [43 ]. The supernatant of CCB cells showing cytopathic effects was clarified by centrifugation at 4000× g for 15 min to pellet the cell debris. Viral nucleocapsid was then extracted from the clarified supernatant using the EZ1 Virus Mini Kit and the EZ1 extraction robot (Qiagen, Manchester, UK) following the manufacturer’s instructions as a positive control on the LAMP reactions.
A fragment of 1450 bp of the CyHV-3 orf90 gene was cloned into the pGem-T Easy plasmid vector (Promega, Southampton, UK) as described before [44 (link)]. The purified DNA plasmid was then used to generate a standard curve for the qPCR quantification. The template (dsDNA) copy number was calculated using a QuantiFluor dsDNA kit in a Quantus fluorimeter (Promega, Southampton, UK), and a dilution series, from 10⁠⁷ to 1 copy, was generated.
For the CEV LAMP assay, a fragment of 528 bp of the CEV p4a gene was amplified using the set of primers CEV ForB and RevJ [18 (link)] and cloned as described above. The purified plasmid DNA was used as a positive control for the CEV qPCR and the LAMP assay.

HEp-2 cells were inoculated with four nasopharyngeal swabs and cultured in Dulbecco’s Modified Eagle Medium supplemented with 100 IU/ml penicillin, 100 μg/ml streptomycin, and 2% (v/v) fetal bovine serum. The cell culture supernatant was collected and cell lysis buffer was added to it (three freeze–thaw cycles) for viral genomic DNA extraction when a 90% cytopathic effect (CPE) was observed. Similarly, the EZ1 Virus Mini Kit (Qiagen, Hilden, Germany) was used for viral DNA extraction. The resulting DNA concentration was measured using the Qubit™ dsDNA BR Assay Kit equipped with a Qubit™ 4 Fluorometer (Thermo Fisher Scientific, United States). DNA was stored at −80°C for library construction.

Nucleic acid was extracted from swabs or respiratory samples using EZ1 Virus mini kit (Cat No. 955134, Qiagen, Germany) performed on a semi-automated system (EZ1, Qiagen, Germany), and stored at -70 °C for more detailed molecular testing. Besides routine standard clinical testing, additional multiplex real-time PCR testing was performed for each extracted sample.
Anyplex RV16 PCR (Cat No. RV7G01Y, Seegene, Korea) was performed for detection of Influenza A virus, Influenza B virus, Human respiratory syncytial virus A, Human respiratory syncytial virus B, Human adenovirus, Human metapneumovirus, Human coronavirus 229E/NL63/OC43, Human parainfluenza virus 1/2/3/4, Human rhinovirus A/B/C, Human enterovirus and Human bocavirus 1/2/3/4.
Anyplex RB5 PCR (Cat No. RB7500Y, Seegene, Korea) was performed for detection of Chlamydophila pneumoniae, Mycoplasma pneumoniae, Legionella pneumophila, Bordetella pertussis, and Bordetella parapertussis. Additional multiplex assays were performed for the detection of Legionella species (non-pneumophila), Chlamydia psittaci, and Burkholderia pseudomallei. Finally, bacterial identification was performed with Vitek MS (Maldi-tof) supplemented by conventional biochemical and identification methods when indicated.

The extraction of viral nucleic acids was performed using the EZ1 Virus Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s recommendations, using 200 µL of concentrated wastewater and eluted in 60 µL of elution buffer and, for the positive control for the evaluation of the concentration procedure, 400 µL of raw, 5-µM filtered wastewater and eluted in 60 µL of elution buffer. For evaluation of the SARS-CoV-2 RNA concentration, real-time PCRs were carried out specifically targeting the N-gene using the primers previously described: forward GACCCCAAAATCAGCGAAAT, reverse: TCTGGTTACTGCCAGTTGAATCTG and probe FAM: ACCCCGCATTACGTTTGGTGGACC -QSY [52 (link)]. The RT-PCR was carried out using the Superscript III Platinum One-step Quantitative RT-PCR systems with the ROX kit (Invitrogen, Waltham, MA, USA) following the manufacturer’s recommendations, with a final concentration of 400 nM of the primers and 200 nM of the probe in a final volume of 25 μL, with 2 μL of RNA. The RT-PCR programme is that described by the manufacturer. The RT-PCR were carried out using a LightCycler 480i (Roche Diagnostics, Basel, Switzerland).

A European strain of KHV, K250, isolated from a KHV outbreak in the UK in 2007, was propagated in the common carp brain (CCB) derived cell line (ECACC 10072802) at 20 °C in EMEM media (Sigma, Gillingham, UK) supplemented with 2 mM Glutamine, 1% non-essential amino acids (Sigma, Gillingham, UK), 2% Foetal Bovine Serum (FBS), and 10 mM HEPES (Sigma, Gillingham, UK) [56 ].
The supernatant of cells showing cytopathic effects was harvested, clarified by centrifugation at 4000× g for 15 min, and stored at 4 °C.
To determine the viral dose, the copy number of the KHV orf90 gene was quantified in a Taqman qPCR test previously described [8 (link)]. Viral nucleocapsid was extracted from the clarified supernatant using the EZ1 Virus Mini Kit and the EZ1 extraction robot (Qiagen, Manchester, UK) following the manufacturer’s instructions. To generate a standard curve, a fragment of 1450 bp of the KHV orf90 gene containing the qPCR region was cloned into the pGem-T Easy plasmid vector (Promega, Southampton, UK) as described before [57 (link)]. The template (dsDNA) copy number was calculated using a QuantiFluor dsDNA kit in a Quantus fluorimeter (Promega, Southampton, UK), and a plasmid dilution series, from 10⁶ to 1 copy, was generated.

Total nucleic acid was extracted from 100 µL of the supernatant of EPC cells showing cytopathic effects (CPEs) using the EZ1 Virus mini kit and an EZ1 extraction robot (QIAGEN, Manchester, UK) following the manufacturer’s instructions. Reverse transcription (RT) was performed at 37 °C for 1 h in a total 20 μL reaction volume consisting of 200 U of M-MLV RT, M-MLV RT 5× reaction buffer (250 mM Tris-HCl, pH 8.3; 375 mM KCl; 15 mM MgCl₂; 50 mM DTT), 1 mM dNTP mix, 500 ng of random primers, 25 units RNasin^® Ribonuclease Inhibitor (Promega, Hampshire, UK) and 4 μL of viral nucleic acid extract.
Inoculated EPC cells showing CPEs were first subjected to a rhabdovirus ELISA test (SVCV Ag ELISA, TestLine, Brno, Czech Republic) and an SVCV-specific PCR and nested PCR using cDNA, as described by the OIE [10 ]. To check for other closely related spriviviruses or possible SVCV variants, a generic nested RT-PCR targeting the L gene of fish vesiculotype viruses was also tested [7 (link)].
To test for the presence of the agent of herpesviral hematopoietic necrosis (HVHN), cyprinid herpes virus-2 (CyHV-2)), a generic PCR and nested-PCR (CyHV-pol assay) targeting the herpesvirus DNA polymerase gene was conducted, as described before [11 (link)], using the extracted viral nucleocapsid of cells inoculated with two pool of samples.